Human ORAI2/C7orf19/CBCIP2 ORF/cDNA clone-Lentivirus particle (NM_032831)

Cat. No.: vGMLP000894

Pre-made Human ORAI2/C7orf19/CBCIP2 Lentiviral expression plasmid for ORAI2 lentivirus packaging, ORAI2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ORAI2/C7orf19 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000894 Human ORAI2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000894
Gene Name ORAI2
Accession Number NM_032831
Gene ID 80228
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 765 bp
Gene Alias C7orf19,CBCIP2,MEM142B,TMEM142B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTGCTGAGCTTAACGTGCCTATCGACCCCTCTGCTCCTGCCTGCCCTGAGCCCGGCCATAAGGGCATGGATTACCGGGACTGGGTCCGCCGCAGCTACCTGGAACTGGTCACCTCTAACCACCACTCGGTACAGGCCCTGTCGTGGCGGAAGCTCTACCTGAGCAGGGCCAAGCTGAAGGCCTCCAGCAGGACCTCCGCCCTCCTCTCCGGCTTTGCCATGGTGGCCATGGTGGAGGTGCAGCTGGAGACGCAGTACCAGTACCCGCGGCCGCTGCTGATTGCCTTCAGCGCCTGCACCACGGTGCTGGTGGCCGTGCACCTGTTCGCCCTCCTCATCAGCACCTGCATCCTGCCCAATGTGGAGGCCGTGAGCAACATCCACAACCTGAACTCCATCAGCGAGTCCCCGCATGAGCGCATGCACCCCTACATCGAGCTGGCCTGGGGCTTCTCCACCGTGCTTGGCATCCTACTCTTCCTGGCCGAGGTGGTGCTGCTCTGCTGGATCAAGTTCCTCCCCGTGGATGCCCGGCGCCAGCCTGGCCCCCCACCTGGCCCTGGGAGTCACACGGGCTGGCAGGCCGCCCTGGTGTCCACCATCATCATGGTGCCCGTGGGCCTCATCTTCGTGGTCTTCACCATCCACTTCTACCGCTCCCTGGTGCGCCACAAAACGGAGCGCCACAACCGCGAGATCGAGGAGCTCCACAAGCTCAAGGTCCAGCTGGACGGGCATGAGCGCAGCCTGCAGGTCTTGTGA
ORF Protein Sequence MSAELNVPIDPSAPACPEPGHKGMDYRDWVRRSYLELVTSNHHSVQALSWRKLYLSRAKLKASSRTSALLSGFAMVAMVEVQLETQYQYPRPLLIAFSACTTVLVAVHLFALLISTCILPNVEAVSNIHNLNSISESPHERMHPYIELAWGFSTVLGILLFLAEVVLLCWIKFLPVDARRQPGPPPGPGSHTGWQAALVSTIIMVPVGLIFVVFTIHFYRSLVRHKTERHNREIEELHKLKVQLDGHERSLQVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1306-Ab Anti-ORAI2 monoclonal antibody
    Target Antigen GM-Tg-g-IP1306-Ag ORAI2 protein
    ORF Viral Vector pGMLP000894 Human ORAI2 Lentivirus plasmid
    ORF Viral Vector vGMLP000894 Human ORAI2 Lentivirus particle


    Target information

    Target ID GM-IP1306
    Target Name ORAI2
    Gene ID 80228, 269717, 714917, 304592, 101090666, 608106, 511233, 100060645
    Gene Symbol and Synonyms A730041O15Rik,C7orf19,CBCIP2,MEM142B,ORAI2,RGD1310213,TMEM142B
    Uniprot Accession Q96SN7
    Uniprot Entry Name ORAI2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000160991
    Target Classification Not Available

    Predicted to enable store-operated calcium channel activity. Predicted to be involved in store-operated calcium entry. Predicted to be located in growth cone. Predicted to be integral component of membrane. Predicted to be active in membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.