Human MAGEA3/CT1.3/HIP8 ORF/cDNA clone-Lentivirus particle (NM_005362)
Cat. No.: vGMLP000903
Pre-made Human MAGEA3/CT1.3/HIP8 Lentiviral expression plasmid for MAGEA3 lentivirus packaging, MAGEA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MAGEA3/CT1.3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000903 | Human MAGEA3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000903 |
| Gene Name | MAGEA3 |
| Accession Number | NM_005362 |
| Gene ID | 4102 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 945 bp |
| Gene Alias | CT1.3,HIP8,HYPD,MAGE3,MAGEA6 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCTCTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAAGAAGGCCTTGAGGCCCGAGGAGAGGCCCTGGGCCTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGGAGGCTGCCTCCTCCTCTTCTACTCTAGTTGAAGTCACCCTGGGGGAGGTGCCTGCTGCCGAGTCACCAGATCCTCCCCAGAGTCCTCAGGGAGCCTCCAGCCTCCCCACTACCATGAACTACCCTCTCTGGAGCCAATCCTATGAGGACTCCAGCAACCAAGAAGAGGAGGGGCCAAGCACCTTCCCTGACCTGGAGTCCGAGTTCCAAGCAGCACTCAGTAGGAAGGTGGCCGAGTTGGTTCATTTTCTGCTCCTCAAGTATCGAGCCAGGGAGCCGGTCACAAAGGCAGAAATGCTGGGGAGTGTCGTCGGAAATTGGCAGTATTTCTTTCCTGTGATCTTCAGCAAAGCTTCCAGTTCCTTGCAGCTGGTCTTTGGCATCGAGCTGATGGAAGTGGACCCCATCGGCCACTTGTACATCTTTGCCACCTGCCTGGGCCTCTCCTACGATGGCCTGCTGGGTGACAATCAGATCATGCCCAAGGCAGGCCTCCTGATAATCGTCCTGGCCATAATCGCAAGAGAGGGCGACTGTGCCCCTGAGGAGAAAATCTGGGAGGAGCTGAGTGTGTTAGAGGTGTTTGAGGGGAGGGAAGACAGTATCTTGGGGGATCCCAAGAAGCTGCTCACCCAACATTTCGTGCAGGAAAACTACCTGGAGTACCGGCAGGTCCCCGGCAGTGATCCTGCATGTTATGAATTCCTGTGGGGTCCAAGGGCCCTCGTTGAAACCAGCTATGTGAAAGTCCTGCACCATATGGTAAAGATCAGTGGAGGACCTCACATTTCCTACCCACCCCTGCATGAGTGGGTTTTGAGAGAGGGGGAAGAGTGA |
| ORF Protein Sequence | MPLEQRSQHCKPEEGLEARGEALGLVGAQAPATEEQEAASSSSTLVEVTLGEVPAAESPDPPQSPQGASSLPTTMNYPLWSQSYEDSSNQEEEGPSTFPDLESEFQAALSRKVAELVHFLLLKYRAREPVTKAEMLGSVVGNWQYFFPVIFSKASSSLQLVFGIELMEVDPIGHLYIFATCLGLSYDGLLGDNQIMPKAGLLIIVLAIIAREGDCAPEEKIWEELSVLEVFEGREDSILGDPKKLLTQHFVQENYLEYRQVPGSDPACYEFLWGPRALVETSYVKVLHHMVKISGGPHISYPPLHEWVLREGEE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T51693-Ab | Anti-MAGEA3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T51693-Ag | MAGEA3 protein |
| ORF Viral Vector | pGMLP000903 | Human MAGEA3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP000903 | Human MAGEA3 Lentivirus particle |
Target information
| Target ID | GM-T51693 |
| Target Name | MAGEA3 |
| Gene ID | 4102 |
| Gene Symbol and Synonyms | CT1.3,HIP8,HYPD,MAGE3,MAGEA3,MAGEA6 |
| Uniprot Accession | P43357 |
| Uniprot Entry Name | MAGA3_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000221867 |
| Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


