Human HMGCL/HL ORF/cDNA clone-Lentivirus particle (NM_001166059.1)

Pre-made Human HMGCL/HL Lentiviral expression plasmid for HMGCL lentivirus packaging, HMGCL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to HMGCL/HL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001268 Human HMGCL Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001268
Gene Name HMGCL
Accession Number NM_001166059.1
Gene ID 3155
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 765 bp
Gene Alias HL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGCAATGAGGAAGGCGCTTCCGCGGCGACTGGTGGGCTTGGCGTCCCTCCGGGCTGTCAGCACCTCATCTATGGGCACTTTACCAAAGCGGGTGAAAATTGTGGAAGTTGGTCCCCGAGATGGACTACAAAATGAAAAGAATATCGTATCTACTCCAGTGAAAATCAAGCTGATAGACATGCTTTCTGAAGCAGGACTCTCTGTTATAGAAACCACCAGCTTTGTGTCTCCTAAGTGGGTTCCCCAGATGGGTGACCACACTGAAGTCTTGAAGGGCATTCAGAAGTTTCCTGGCATCAACTACCCAGTCCTGACCCCAAATTTGAAAGGCTTCGAGGCAGCGGTCACCAAGAAGTTCTACTCAATGGGCTGCTACGAGATCTCCCTGGGGGACACCATTGGTGTGGGCACCCCAGGGATCATGAAAGACATGCTATCTGCTGTCATGCAGGAAGTGCCTCTGGCTGCCCTGGCTGTCCACTGCCATGACACCTATGGTCAAGCCCTGGCCAACACCTTGATGGCCCTGCAGATGGGAGTGAGTGTCGTGGACTCTTCTGTGGCAGGACTTGGAGGCTGTCCCTACGCACAGGGGGCATCAGGAAACTTGGCCACAGAAGACCTGGTCTACATGCTAGAGGGCTTGGGCATTCACACGGGTGTGAATCTCCAGAAGCTTCTGGAAGCTGGAAACTTTATCTGTCAAGCCCTGAACAGAAAAACTAGCTCCAAAGTGGCTCAGGCTACCTGTAAACTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1472-Ab Anti-HMGCL/ HL functional antibody
    Target Antigen GM-Tg-g-SE1472-Ag HMGCL protein
    ORF Viral Vector pGMLP001268 Human HMGCL Lentivirus plasmid
    ORF Viral Vector vGMLP001268 Human HMGCL Lentivirus particle


    Target information

    Target ID GM-SE1472
    Target Name HMGCL
    Gene ID 3155, 15356, 710833, 79238, 101099569, 100855521, 317658, 100057686
    Gene Symbol and Synonyms HL,HMGCL
    Uniprot Accession P35914
    Uniprot Entry Name HMGCL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000117305
    Target Classification Not Available

    The protein encoded by this gene belongs to the HMG-CoA lyase family. It is a mitochondrial enzyme that catalyzes the final step of leucine degradation and plays a key role in ketone body formation. Mutations in this gene are associated with HMG-CoA lyase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.