Human STK4/KRS2/MST1 ORF/cDNA clone-Lentivirus particle (NM_006282)

Cat. No.: vGMLP001370

Pre-made Human STK4/KRS2/MST1 Lentiviral expression plasmid for STK4 lentivirus packaging, STK4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to STK4/KRS2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001370 Human STK4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001370
Gene Name STK4
Accession Number NM_006282
Gene ID 6789
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1464 bp
Gene Alias KRS2,MST1,YSK3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGACGGTACAGCTGAGGAACCCGCCGCGCCGGCAGCTGAAAAAGTTGGATGAAGATAGTTTAACCAAACAACCAGAAGAAGTATTTGATGTCTTAGAGAAACTTGGAGAAGGGTCCTATGGCAGCGTATACAAAGCTATTCATAAAGAGACCGGCCAGATTGTTGCTATTAAGCAAGTTCCTGTGGAATCAGACCTCCAGGAGATAATCAAAGAAATCTCTATAATGCAGCAATGTGACAGCCCTCATGTAGTCAAATATTATGGCAGTTATTTTAAGAACACAGACTTATGGATCGTTATGGAGTACTGTGGGGCTGGTTCTGTATCTGATATCATTCGATTACGAAATAAAACGTTAACAGAAGATGAAATAGCTACAATATTACAATCAACTCTTAAGGGACTTGAATACCTTCATTTTATGAGAAAAATACACCGAGATATCAAGGCAGGAAATATTTTGCTAAATACAGAAGGACATGCAAAACTTGCAGATTTTGGGGTAGCAGGTCAACTTACAGATACCATGGCCAAGCGGAATACAGTGATAGGAACACCATTTTGGATGGCTCCAGAAGTGATTCAGGAAATTGGATACAACTGTGTAGCAGACATCTGGTCCCTGGGAATAACTGCCATAGAAATGGCTGAAGGAAAGCCCCCTTATGCTGATATCCATCCAATGAGGGCAATCTTCATGATTCCTACAAATCCTCCTCCCACATTCCGAAAACCAGAGCTATGGTCAGATAACTTTACAGATTTTGTGAAACAGTGTCTTGTAAAGAGCCCTGAGCAGAGGGCCACAGCCACTCAGCTCCTGCAGCACCCATTTGTCAGGAGTGCCAAAGGAGTGTCAATACTGCGAGACTTAATTAATGAAGCCATGGATGTGAAACTGAAACGCCAGGAATCCCAGCAGCGGGAAGTGGACCAGGACGATGAAGAAAACTCAGAAGAGGATGAAATGGATTCTGGCACGATGGTTCGAGCAGTGGGTGATGAGATGGGCACTGTCCGAGTAGCCAGCACCATGACTGATGGAGCCAATACTATGATTGAGCACGATGACACGTTGCCATCACAACTGGGCACCATGGTGATCAATGCAGAGGATGAGGAAGAGGAAGGAACTATGAAAAGAAGGGATGAGACCATGCAGCCTGCGAAACCATCCTTTCTTGAATATTTTGAACAAAAAGAAAAGGAAAACCAGATCAACAGCTTTGGCAAGAGTGTACCTGGTCCACTGAAAAATTCTTCAGATTGGAAAATACCACAGGATGGAGACTACGAGTTTCTTAAGAGTTGGACAGTGGAGGACCTTCAGAAGAGGCTCTTGGCCCTGGACCCCATGATGGAGCAGGAGATTGAAGAGATCCGGCAGAAGTACCAGTCCAAGCGGCAGCCCATCCTGGATGCCATAGAGGCTAAGAAGAGACGGCAACAAAACTTCTGA
ORF Protein Sequence METVQLRNPPRRQLKKLDEDSLTKQPEEVFDVLEKLGEGSYGSVYKAIHKETGQIVAIKQVPVESDLQEIIKEISIMQQCDSPHVVKYYGSYFKNTDLWIVMEYCGAGSVSDIIRLRNKTLTEDEIATILQSTLKGLEYLHFMRKIHRDIKAGNILLNTEGHAKLADFGVAGQLTDTMAKRNTVIGTPFWMAPEVIQEIGYNCVADIWSLGITAIEMAEGKPPYADIHPMRAIFMIPTNPPPTFRKPELWSDNFTDFVKQCLVKSPEQRATATQLLQHPFVRSAKGVSILRDLINEAMDVKLKRQESQQREVDQDDEENSEEDEMDSGTMVRAVGDEMGTVRVASTMTDGANTMIEHDDTLPSQLGTMVINAEDEEEEGTMKRRDETMQPAKPSFLEYFEQKEKENQINSFGKSVPGPLKNSSDWKIPQDGDYEFLKSWTVEDLQKRLLALDPMMEQEIEEIRQKYQSKRQPILDAIEAKKRRQQNF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47164-Ab Anti-STK4 monoclonal antibody
    Target Antigen GM-Tg-g-T47164-Ag STK4 protein
    ORF Viral Vector pGMLP001357 Human STK4 Lentivirus plasmid
    ORF Viral Vector pGMLP001370 Human STK4 Lentivirus plasmid
    ORF Viral Vector pGMLP005723 Human STK4 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-283 Human STK4 Adenovirus plasmid
    ORF Viral Vector pGMPC000456 Human STK4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001357 Human STK4 Lentivirus particle
    ORF Viral Vector vGMLP001370 Human STK4 Lentivirus particle
    ORF Viral Vector vGMLP005723 Human STK4 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-283 Human STK4 Adenovirus particle


    Target information

    Target ID GM-T47164
    Target Name STK4
    Gene ID 6789, 58231, 717730, 311622, 101091185, 477240, 514886, 100070861
    Gene Symbol and Synonyms Kas-2,KRS2,MST1,STK4,YSK3
    Uniprot Accession Q13043
    Uniprot Entry Name STK4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000101109
    Target Classification Kinase

    The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.