Human HERPUD1/HERP/Mif1 ORF/cDNA clone-Lentivirus particle (NM_014685)

Cat. No.: vGMLP001391

Pre-made Human HERPUD1/HERP/Mif1 Lentiviral expression plasmid for HERPUD1 lentivirus packaging, HERPUD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to HERPUD1/HERP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001391 Human HERPUD1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001391
Gene Name HERPUD1
Accession Number NM_014685
Gene ID 9709
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1176 bp
Gene Alias HERP,Mif1,SUP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTCCGAGACCGAACCCGAGCCCGTCACGCTCCTGGTGAAGAGCCCCAACCAGCGCCACCGCGACTTGGAGCTGAGTGGCGACCGCGGCTGGAGTGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCCGAGCGTCCGCGTCCAGAGGACCAGAGGTTAATTTATTCTGGGAAGCTGTTGTTGGATCACCAATGTCTCAGGGACTTGCTTCCAAAGCAGGAAAAACGGCATGTTTTGCATCTGGTGTGCAATGTGAAGAGTCCTTCAAAAATGCCAGAAATCAACGCCAAGGTGGCTGAATCCACAGAGGAGCCTGCTGGTTCTAATCGGGGACAGTATCCTGAGGATTCCTCAAGTGATGGTTTAAGGCAAAGGGAAGTTCTTCGGAACCTTTCTTCCCCTGGATGGGAAAACATCTCAAGGCCTGAAGCTGCCCAGCAGGCATTCCAAGGCCTGGGTCCTGGTTTCTCCGGTTACACACCCTATGGGTGGCTTCAGCTTTCCTGGTTCCAGCAGATATATGCACGACAGTACTACATGCAATATTTAGCAGCCACTGCTGCATCAGGGGCTTTTGTTCCACCACCAAGTGCACAAGAGATACCTGTGGTCTCTGCACCTGCTCCAGCCCCTATTCACAACCAGTTTCCAGCTGAAAACCAGCCTGCCAATCAGAATGCTGCTCCTCAAGTGGTTGTTAATCCTGGAGCCAATCAAAATTTGCGGATGAATGCACAAGGTGGCCCTATTGTGGAAGAAGATGATGAAATAAATCGAGATTGGTTGGATTGGACCTATTCAGCAGCTACATTTTCTGTTTTTCTCAGTATCCTCTACTTCTACTCCTCCCTGAGCAGATTCCTCATGGTCATGGGGGCCACCGTTGTTATGTACCTGCATCACGTTGGGTGGTTTCCATTTAGACCGAGGCCGGTTCAGAACTTCCCAAATGATGGTCCTCCTCCTGACGTTGTAAATCAGGACCCCAACAATAACTTACAGGAAGGCACTGATCCTGAAACTGAAGACCCCAACCACCTCCCTCCAGACAGGGATGTACTAGATGGCGAGCAGACCAGCCCCTCCTTTATGAGCACAGCATGGCTTGTCTTCAAGACTTTCTTTGCCTCTCTTCTTCCAGAAGGCCCCCCAGCCATCGCAAACTGA
ORF Protein Sequence MESETEPEPVTLLVKSPNQRHRDLELSGDRGWSVGHLKAHLSRVYPERPRPEDQRLIYSGKLLLDHQCLRDLLPKQEKRHVLHLVCNVKSPSKMPEINAKVAESTEEPAGSNRGQYPEDSSSDGLRQREVLRNLSSPGWENISRPEAAQQAFQGLGPGFSGYTPYGWLQLSWFQQIYARQYYMQYLAATAASGAFVPPPSAQEIPVVSAPAPAPIHNQFPAENQPANQNAAPQVVVNPGANQNLRMNAQGGPIVEEDDEINRDWLDWTYSAATFSVFLSILYFYSSLSRFLMVMGATVVMYLHHVGWFPFRPRPVQNFPNDGPPPDVVNQDPNNNLQEGTDPETEDPNHLPPDRDVLDGEQTSPSFMSTAWLVFKTFFASLLPEGPPAIAN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2538-Ab Anti-HERPUD1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2538-Ag HERPUD1 protein
    ORF Viral Vector pGMLP001391 Human HERPUD1 Lentivirus plasmid
    ORF Viral Vector vGMLP001391 Human HERPUD1 Lentivirus particle


    Target information

    Target ID GM-IP2538
    Target Name HERPUD1
    Gene ID 9709, 64209, 703210, 85430, 101082710, 478116, 613577, 100062120
    Gene Symbol and Synonyms HERP,HERPUD1,Mif1,Mifl,SUP
    Uniprot Accession Q15011
    Uniprot Entry Name HERP1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000051108
    Target Classification Tumor-associated antigen (TAA)

    The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.