Human HERPUD1/HERP/Mif1 ORF/cDNA clone-Lentivirus particle (NM_014685)
Cat. No.: vGMLP001391
Pre-made Human HERPUD1/HERP/Mif1 Lentiviral expression plasmid for HERPUD1 lentivirus packaging, HERPUD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HERPUD1/HERP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001391 | Human HERPUD1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001391 |
Gene Name | HERPUD1 |
Accession Number | NM_014685 |
Gene ID | 9709 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1176 bp |
Gene Alias | HERP,Mif1,SUP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAGTCCGAGACCGAACCCGAGCCCGTCACGCTCCTGGTGAAGAGCCCCAACCAGCGCCACCGCGACTTGGAGCTGAGTGGCGACCGCGGCTGGAGTGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCCGAGCGTCCGCGTCCAGAGGACCAGAGGTTAATTTATTCTGGGAAGCTGTTGTTGGATCACCAATGTCTCAGGGACTTGCTTCCAAAGCAGGAAAAACGGCATGTTTTGCATCTGGTGTGCAATGTGAAGAGTCCTTCAAAAATGCCAGAAATCAACGCCAAGGTGGCTGAATCCACAGAGGAGCCTGCTGGTTCTAATCGGGGACAGTATCCTGAGGATTCCTCAAGTGATGGTTTAAGGCAAAGGGAAGTTCTTCGGAACCTTTCTTCCCCTGGATGGGAAAACATCTCAAGGCCTGAAGCTGCCCAGCAGGCATTCCAAGGCCTGGGTCCTGGTTTCTCCGGTTACACACCCTATGGGTGGCTTCAGCTTTCCTGGTTCCAGCAGATATATGCACGACAGTACTACATGCAATATTTAGCAGCCACTGCTGCATCAGGGGCTTTTGTTCCACCACCAAGTGCACAAGAGATACCTGTGGTCTCTGCACCTGCTCCAGCCCCTATTCACAACCAGTTTCCAGCTGAAAACCAGCCTGCCAATCAGAATGCTGCTCCTCAAGTGGTTGTTAATCCTGGAGCCAATCAAAATTTGCGGATGAATGCACAAGGTGGCCCTATTGTGGAAGAAGATGATGAAATAAATCGAGATTGGTTGGATTGGACCTATTCAGCAGCTACATTTTCTGTTTTTCTCAGTATCCTCTACTTCTACTCCTCCCTGAGCAGATTCCTCATGGTCATGGGGGCCACCGTTGTTATGTACCTGCATCACGTTGGGTGGTTTCCATTTAGACCGAGGCCGGTTCAGAACTTCCCAAATGATGGTCCTCCTCCTGACGTTGTAAATCAGGACCCCAACAATAACTTACAGGAAGGCACTGATCCTGAAACTGAAGACCCCAACCACCTCCCTCCAGACAGGGATGTACTAGATGGCGAGCAGACCAGCCCCTCCTTTATGAGCACAGCATGGCTTGTCTTCAAGACTTTCTTTGCCTCTCTTCTTCCAGAAGGCCCCCCAGCCATCGCAAACTGA |
ORF Protein Sequence | MESETEPEPVTLLVKSPNQRHRDLELSGDRGWSVGHLKAHLSRVYPERPRPEDQRLIYSGKLLLDHQCLRDLLPKQEKRHVLHLVCNVKSPSKMPEINAKVAESTEEPAGSNRGQYPEDSSSDGLRQREVLRNLSSPGWENISRPEAAQQAFQGLGPGFSGYTPYGWLQLSWFQQIYARQYYMQYLAATAASGAFVPPPSAQEIPVVSAPAPAPIHNQFPAENQPANQNAAPQVVVNPGANQNLRMNAQGGPIVEEDDEINRDWLDWTYSAATFSVFLSILYFYSSLSRFLMVMGATVVMYLHHVGWFPFRPRPVQNFPNDGPPPDVVNQDPNNNLQEGTDPETEDPNHLPPDRDVLDGEQTSPSFMSTAWLVFKTFFASLLPEGPPAIAN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2538-Ab | Anti-HERPUD1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2538-Ag | HERPUD1 protein |
ORF Viral Vector | pGMLP001391 | Human HERPUD1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001391 | Human HERPUD1 Lentivirus particle |
Target information
Target ID | GM-IP2538 |
Target Name | HERPUD1 |
Gene ID | 9709, 64209, 703210, 85430, 101082710, 478116, 613577, 100062120 |
Gene Symbol and Synonyms | HERP,HERPUD1,Mif1,Mifl,SUP |
Uniprot Accession | Q15011 |
Uniprot Entry Name | HERP1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000051108 |
Target Classification | Tumor-associated antigen (TAA) |
The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.