Human WNT16 ORF/cDNA clone-Lentivirus particle (NM_057168)
Pre-made Human WNT16/ Lentiviral expression plasmid for WNT16 lentivirus packaging, WNT16 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to WNT16/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001440 | Human WNT16 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001440 |
Gene Name | WNT16 |
Accession Number | NM_057168 |
Gene ID | 51384 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1098 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACAGGGCGGCGCTCCTGGGACTGGCCCGCTTGTGCGCGCTGTGGGCAGCCCTGCTCGTGCTGTTCCCCTACGGAGCCCAAGGAAACTGGATGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTGCGCCAATTTGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCATCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGATGGAACTGCATGATCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTGGCTACGAGCTGAGCAGCGGCACCAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAGGCCTGGTGCATTCTGTGACCAGGTCATGCAGTGCAGGCAACATGACAGAGTGTTCCTGTGACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAAGGCTGGCACTGGGGGGGCTGCTCCGATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGATTTCCCCATCGGAAACACCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAAGCTGGAAGGCAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCTGTGCTGTGAAAACATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGAAGGATAAATATGAAAACAGTATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGAGAGAAAAAGATCAGAGGAAAATACCAATCCATAAGGATGATCTGCTCTATGTTAATAAGTCTCCCAACTACTGTGTAGAAGATAAGAAACTGGGAATCCCAGGGACACAAGGCAGAGAATGCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTCCTCTGCTGTGGCCGAGGTTACAACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATCTGGTGCTGCTATGTCCGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0557-Ab | Anti-WNT16 functional antibody |
Target Antigen | GM-Tg-g-SE0557-Ag | WNT16 protein |
Cytokine | cks-Tg-g-GM-SE0557 | wingless-type MMTV integration site family, member 16 (WNT16) protein & antibody |
ORF Viral Vector | pGMLP001440 | Human WNT16 Lentivirus plasmid |
ORF Viral Vector | vGMLP001440 | Human WNT16 Lentivirus particle |
Target information
Target ID | GM-SE0557 |
Target Name | WNT16 |
Gene ID | 51384, 93735, 694069, 500047, 101090252, 612328, 538627, 100071393 |
Gene Symbol and Synonyms | E130309I19Rik,WNT16 |
Uniprot Accession | Q9UBV4 |
Uniprot Entry Name | WNT16_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000002745 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.