Human FOXQ1/HFH1 ORF/cDNA clone-Lentivirus particle (NM_033260)

Cat. No.: vGMLP001504

Pre-made Human FOXQ1/HFH1 Lentiviral expression plasmid for FOXQ1 lentivirus packaging, FOXQ1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to FOXQ1/HFH1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001504 Human FOXQ1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001504
Gene Name FOXQ1
Accession Number NM_033260
Gene ID 94234
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1212 bp
Gene Alias HFH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGTTGGAGGTGTTCGTCCCTCGCGCGGCCCACGGGGACAAGCAGGGCAGTGACCTGGAGGGCGCGGGCGGCAGCGACGCGCCGTCCCCGCTGTCGGCGGCGGGAGACGACTCCCTGGGCTCAGATGGGGACTGCGCGGCCAACAGCCCGGCCGCGGGCGGCGGCGCCAGAGATACGCAGGGCGACGGCGAACAGAGTGCGGGAGGCGGGCCGGGCGCGGAGGAGGCGATCCCGGCAGCAGCTGCTGCAGCGGTGGTGGCGGAGGGCGCGGAGGCCGGGGCGGCGGGGCCAGGCGCGGGCGGCGCGGGGAGCGGCGAGGGTGCACGCAGCAAGCCATATACGCGGCGGCCCAAGCCCCCCTACTCGTACATCGCGCTCATCGCCATGGCCATCCGCGACTCGGCGGGCGGGCGCTTGACGCTGGCGGAGATCAACGAGTACCTCATGGGCAAGTTCCCCTTTTTCCGCGGCAGCTACACGGGCTGGCGCAACTCCGTGCGCCACAACCTTTCGCTCAACGACTGCTTCGTCAAGGTGCTGCGCGACCCCTCGCGGCCCTGGGGCAAGGACAACTACTGGATGCTCAACCCCAACAGCGAGTACACCTTCGCCGACGGGGTCTTCCGCCGCCGCCGCAAGCGCCTCAGCCACCGCGCGCCGGTCCCCGCGCCCGGGCTGCGGCCCGAGGAGGCCCCGGGCCTCCCCGCCGCCCCGCCGCCCGCGCCCGCCGCCCCGGCCTCGCCCCGCATGCGCTCGCCCGCCCGCCAGGAGGAGCGCGCCAGCCCCGCGGGCAAGTTCTCCAGCTCCTTCGCCATCGACAGCATCCTGCGCAAGCCCTTCCGCAGCCGCCGCCTCAGGGACACGGCCCCCGGGACGACGCTTCAGTGGGGCGCCGCGCCCTGCCCGCCGCTGCCCGCGTTCCCCGCGCTCCTCCCCGCGGCGCCCTGCAGGGCCCTGCTGCCGCTCTGCGCGTACGGCGCGGGCGAGCCGGCGCGGCTGGGCGCGCGCGAGGCCGAGGTGCCACCGACCGCGCCGCCCCTCCTGCTTGCACCTCTCCCGGCGGCGGCCCCCGCCAAGCCACTCCGAGGCCCGGCGGCCGGCGGCGCGCACCTGTACTGCCCCCTGCGGCTGCCCGCAGCCCTGCAGGCGGCCTCAGTCCGCCGCCCTGGCCCGCACCTGCCGTACCCGGTGGAGACGCTCCTAGCCTGA
ORF Protein Sequence MKLEVFVPRAAHGDKQGSDLEGAGGSDAPSPLSAAGDDSLGSDGDCAANSPAAGGGARDTQGDGEQSAGGGPGAEEAIPAAAAAAVVAEGAEAGAAGPGAGGAGSGEGARSKPYTRRPKPPYSYIALIAMAIRDSAGGRLTLAEINEYLMGKFPFFRGSYTGWRNSVRHNLSLNDCFVKVLRDPSRPWGKDNYWMLNPNSEYTFADGVFRRRRKRLSHRAPVPAPGLRPEEAPGLPAAPPPAPAAPASPRMRSPARQEERASPAGKFSSSFAIDSILRKPFRSRRLRDTAPGTTLQWGAAPCPPLPAFPALLPAAPCRALLPLCAYGAGEPARLGAREAEVPPTAPPLLLAPLPAAAPAKPLRGPAAGGAHLYCPLRLPAALQAASVRRPGPHLPYPVETLLA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38428-Ab Anti-FOXQ1 monoclonal antibody
    Target Antigen GM-Tg-g-T38428-Ag FOXQ1 protein
    ORF Viral Vector pGMLP001504 Human FOXQ1 Lentivirus plasmid
    ORF Viral Vector vGMLP001504 Human FOXQ1 Lentivirus particle


    Target information

    Target ID GM-T38428
    Target Name FOXQ1
    Gene ID 94234, 15220, 722908, 64826, 101090186, 119867749, 112443729, 100049962
    Gene Symbol and Synonyms FOXQ1,HFH-1,HFH1,Hfh1l,sa
    Uniprot Accession Q9C009
    Uniprot Entry Name FOXQ1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000164379
    Target Classification Not Available

    FOXQ1 is a member of the FOX gene family, which is characterized by a conserved 110-amino acid DNA-binding motif called the forkhead or winged helix domain. FOX genes are involved in embryonic development, cell cycle regulation, tissue-specific gene expression, cell signaling, and tumorigenesis (Bieller et al., 2001 [PubMed 11747606]).[supplied by OMIM, May 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.