Human ELAVL1/ELAV1/Hua ORF/cDNA clone-Lentivirus particle (NM_001419.2)

Cat. No.: vGMLP001935

Pre-made Human ELAVL1/ELAV1/Hua Lentiviral expression plasmid for ELAVL1 lentivirus packaging, ELAVL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ELAVL1/ELAV1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001935 Human ELAVL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001935
Gene Name ELAVL1
Accession Number NM_001419.2
Gene ID 1994
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 981 bp
Gene Alias ELAV1,Hua,HUR,MelG
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCAGGGGTGACATCGGGAGAACGAATTTGATCGTCAACTACCTCCCTCAGAACATGACCCAGGATGAGTTACGAAGCCTGTTCAGCAGCATTGGTGAAGTTGAATCTGCAAAACTTATTCGGGATAAAGTAGCAGGACACAGCTTGGGCTATGGCTTTGTGAACTACGTGACCGCGAAGGATGCAGAGAGAGCGATCAACACGCTGAACGGCTTGAGGCTCCAGTCAAAAACCATTAAGGTGTCGTATGCTCGCCCGAGCTCAGAGGTGATCAAAGACGCCAACTTGTACATCAGCGGGCTCCCGCGGACCATGACCCAGAAGGACGTAGAAGACATGTTCTCTCGGTTTGGGCGGATCATCAACTCGCGGGTCCTCGTGGATCAGACTACAGGTTTGTCCAGAGGGGTTGCGTTTATCCGGTTTGACAAACGGTCGGAGGCAGAAGAGGCAATTACCAGTTTCAATGGTCATAAACCCCCAGGTTCCTCTGAGCCCATCACAGTGAAGTTTGCAGCCAACCCCAACCAGAACAAAAACGTGGCACTCCTCTCGCAGCTGTACCACTCGCCAGCGCGACGGTTCGGAGGCCCCGTTCACCACCAGGCGCAGAGATTCAGGTTCTCCCCCATGGGCGTCGATCACATGAGCGGGCTCTCTGGCGTCAACGTGCCAGGAAACGCCTCCTCCGGCTGGTGCATTTTCATCTACAACCTGGGGCAGGATGCCGACGAGGGGATCCTCTGGCAGATGTTTGGGCCGTTTGGTGCCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAA
ORF Protein Sequence MSNGYEDHMAEDCRGDIGRTNLIVNYLPQNMTQDELRSLFSSIGEVESAKLIRDKVAGHSLGYGFVNYVTAKDAERAINTLNGLRLQSKTIKVSYARPSSEVIKDANLYISGLPRTMTQKDVEDMFSRFGRIINSRVLVDQTTGLSRGVAFIRFDKRSEAEEAITSFNGHKPPGSSEPITVKFAANPNQNKNVALLSQLYHSPARRFGGPVHHQAQRFRFSPMGVDHMSGLSGVNVPGNASSGWCIFIYNLGQDADEGILWQMFGPFGAVTNVKVIRDFNTNKCKGFGFVTMTNYEEAAMAIASLNGYRLGDKILQVSFKTNKSHK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78349-Ab Anti-ELAVL1 monoclonal antibody
    Target Antigen GM-Tg-g-T78349-Ag ELAVL1 protein
    ORF Viral Vector pGMLP001935 Human ELAVL1 Lentivirus plasmid
    ORF Viral Vector pGMLV001266 Human ELAVL1 Lentivirus plasmid
    ORF Viral Vector pGMPC000169 Human ELAVL1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000347 Human ELAVL1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001829 Human ELAVL1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001935 Human ELAVL1 Lentivirus particle
    ORF Viral Vector vGMLV001266 Human ELAVL1 Lentivirus particle


    Target information

    Target ID GM-T78349
    Target Name ELAVL1
    Gene ID 1994, 15568, 705806, 363854, 101094402, 611201, 617316, 100060819
    Gene Symbol and Synonyms 2410055N02Rik,ELAV1,ELAVL1,Hua,HUR,MelG
    Uniprot Accession Q15717
    Uniprot Entry Name ELAV1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000066044
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.