Human ELAVL1/ELAV1/Hua ORF/cDNA clone-Lentivirus particle (NM_001419.2)
Cat. No.: vGMLP001935
Pre-made Human ELAVL1/ELAV1/Hua Lentiviral expression plasmid for ELAVL1 lentivirus packaging, ELAVL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ELAVL1/ELAV1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001935 | Human ELAVL1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001935 |
Gene Name | ELAVL1 |
Accession Number | NM_001419.2 |
Gene ID | 1994 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 981 bp |
Gene Alias | ELAV1,Hua,HUR,MelG |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCAGGGGTGACATCGGGAGAACGAATTTGATCGTCAACTACCTCCCTCAGAACATGACCCAGGATGAGTTACGAAGCCTGTTCAGCAGCATTGGTGAAGTTGAATCTGCAAAACTTATTCGGGATAAAGTAGCAGGACACAGCTTGGGCTATGGCTTTGTGAACTACGTGACCGCGAAGGATGCAGAGAGAGCGATCAACACGCTGAACGGCTTGAGGCTCCAGTCAAAAACCATTAAGGTGTCGTATGCTCGCCCGAGCTCAGAGGTGATCAAAGACGCCAACTTGTACATCAGCGGGCTCCCGCGGACCATGACCCAGAAGGACGTAGAAGACATGTTCTCTCGGTTTGGGCGGATCATCAACTCGCGGGTCCTCGTGGATCAGACTACAGGTTTGTCCAGAGGGGTTGCGTTTATCCGGTTTGACAAACGGTCGGAGGCAGAAGAGGCAATTACCAGTTTCAATGGTCATAAACCCCCAGGTTCCTCTGAGCCCATCACAGTGAAGTTTGCAGCCAACCCCAACCAGAACAAAAACGTGGCACTCCTCTCGCAGCTGTACCACTCGCCAGCGCGACGGTTCGGAGGCCCCGTTCACCACCAGGCGCAGAGATTCAGGTTCTCCCCCATGGGCGTCGATCACATGAGCGGGCTCTCTGGCGTCAACGTGCCAGGAAACGCCTCCTCCGGCTGGTGCATTTTCATCTACAACCTGGGGCAGGATGCCGACGAGGGGATCCTCTGGCAGATGTTTGGGCCGTTTGGTGCCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAA |
ORF Protein Sequence | MSNGYEDHMAEDCRGDIGRTNLIVNYLPQNMTQDELRSLFSSIGEVESAKLIRDKVAGHSLGYGFVNYVTAKDAERAINTLNGLRLQSKTIKVSYARPSSEVIKDANLYISGLPRTMTQKDVEDMFSRFGRIINSRVLVDQTTGLSRGVAFIRFDKRSEAEEAITSFNGHKPPGSSEPITVKFAANPNQNKNVALLSQLYHSPARRFGGPVHHQAQRFRFSPMGVDHMSGLSGVNVPGNASSGWCIFIYNLGQDADEGILWQMFGPFGAVTNVKVIRDFNTNKCKGFGFVTMTNYEEAAMAIASLNGYRLGDKILQVSFKTNKSHK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T78349-Ab | Anti-ELAVL1 monoclonal antibody |
Target Antigen | GM-Tg-g-T78349-Ag | ELAVL1 protein |
ORF Viral Vector | pGMLP001935 | Human ELAVL1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001266 | Human ELAVL1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000169 | Human ELAVL1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000347 | Human ELAVL1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001829 | Human ELAVL1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP001935 | Human ELAVL1 Lentivirus particle |
ORF Viral Vector | vGMLV001266 | Human ELAVL1 Lentivirus particle |
Target information
Target ID | GM-T78349 |
Target Name | ELAVL1 |
Gene ID | 1994, 15568, 705806, 363854, 101094402, 611201, 617316, 100060819 |
Gene Symbol and Synonyms | 2410055N02Rik,ELAV1,ELAVL1,Hua,HUR,MelG |
Uniprot Accession | Q15717 |
Uniprot Entry Name | ELAV1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000066044 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.