Human FGF1/AFGF/ ECGF ORF/cDNA clone-Lentivirus particle (NM_000800.4 )

Pre-made Human FGF1/AFGF/ ECGF Lentiviral expression plasmid for FGF1 lentivirus packaging, FGF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FGF1/AFGF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001937 Human FGF1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001937
Gene Name FGF1
Accession Number NM_000800.4
Gene ID 2246
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 468 bp
Gene Alias AFGF, ECGF, ECGF-beta, ECGFA, ECGFB, FGF-1, FGF-alpha, FGFA, GLIO703, HBGF-1, HBGF1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCAGGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATCCTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACATTCAGCTGCAGCTCAGTGCGGAAAGCGTGGGGGAGGTGTATATAAAGAGTACCGAGACTGGCCAGTACTTGGCCATGGACACCGACGGGCTTTTATACGGCTCACAGACACCAAATGAGGAATGTTTGTTCCTGGAAAGGCTGGAGGAGAACCATTACAACACCTATATATCCAAGAAGCATGCAGAGAAGAATTGGTTTGTTGGCCTCAAGAAGAATGGGAGCTGCAAACGCGGTCCTCGGACTCACTATGGCCAGAAAGCAATCTTGTTTCTCCCCCTGCCAGTCTCTTCTGATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T18639-Ab Anti-FGF1/ AFGF/ ECGF functional antibody
    Target Antigen GM-Tg-g-T18639-Ag FGF1 protein
    Cytokine cks-Tg-g-GM-T18639 fibroblast growth factor 1 (acidic) (FGF1) protein & antibody
    ORF Viral Vector pGMLP001937 Human FGF1 Lentivirus plasmid
    ORF Viral Vector vGMLP001937 Human FGF1 Lentivirus particle


    Target information

    Target ID GM-T18639
    Target Name FGF1
    Gene ID 2246, 14164, 705970, 25317, 101082206, 607724, 281160, 100033960
    Gene Symbol and Synonyms AFGF,Dffrx,ECGF,ECGF-beta,ECGFA,ECGFB,EDGF,EDGF II,Fam,FGF-1,FGF-alpha,FGF1,Fgf2b,FGFA,GLIO703,HBGF-1,HBGF1
    Uniprot Accession P05230
    Uniprot Entry Name FGF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000113578
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.