Human RGS2/G0S8 ORF/cDNA clone-Lentivirus particle (NM_002923)

Cat. No.: vGMLP002178

Pre-made Human RGS2/G0S8 Lentiviral expression plasmid for RGS2 lentivirus packaging, RGS2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RGS2/G0S8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002178 Human RGS2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002178
Gene Name RGS2
Accession Number NM_002923
Gene ID 5997
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 636 bp
Gene Alias G0S8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAAAGTGCTATGTTCTTGGCTGTTCAACACGACTGCAGACCCATGGACAAGAGCGCAGGCAGTGGCCACAAGAGCGAGGAGAAGCGAGAAAAGATGAAACGGACCCTTTTAAAAGATTGGAAGACCCGTTTGAGCTACTTCTTACAAAATTCCTCTACTCCTGGGAAGCCCAAAACCGGCAAAAAAAGCAAACAGCAAGCTTTCATCAAGCCTTCTCCTGAGGAAGCACAGCTGTGGTCAGAAGCATTTGACGAGCTGCTAGCCAGCAAATATGGTCTTGCTGCATTCAGGGCTTTTTTAAAGTCGGAATTCTGTGAAGAAAATATTGAATTCTGGCTGGCCTGTGAAGACTTCAAAAAAACCAAATCACCCCAAAAGCTGTCCTCAAAAGCAAGGAAAATATATACTGACTTCATAGAAAAGGAAGCTCCAAAAGAGATAAACATAGATTTTCAAACCAAAACTCTGATTGCCCAGAATATACAAGAAGCTACAAGTGGCTGCTTTACAACTGCCCAGAAAAGGGTATACAGCTTGATGGAGAACAACTCTTATCCTCGTTTCTTGGAGTCAGAATTCTACCAGGACTTGTGTAAAAAGCCACAAATCACCACAGAGCCTCATGCTACATGA
ORF Protein Sequence MQSAMFLAVQHDCRPMDKSAGSGHKSEEKREKMKRTLLKDWKTRLSYFLQNSSTPGKPKTGKKSKQQAFIKPSPEEAQLWSEAFDELLASKYGLAAFRAFLKSEFCEENIEFWLACEDFKKTKSPQKLSSKARKIYTDFIEKEAPKEINIDFQTKTLIAQNIQEATSGCFTTAQKRVYSLMENNSYPRFLESEFYQDLCKKPQITTEPHAT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38325-Ab Anti-RGS2 monoclonal antibody
    Target Antigen GM-Tg-g-T38325-Ag RGS2 protein
    ORF Viral Vector pGMLP002178 Human RGS2 Lentivirus plasmid
    ORF Viral Vector vGMLP002178 Human RGS2 Lentivirus particle


    Target information

    Target ID GM-T38325
    Target Name RGS2
    Gene ID 5997, 19735, 712617, 84583, 101088456, 488584, 100848920, 100051067
    Gene Symbol and Synonyms G0S8,GOS8,RGS2
    Uniprot Accession P41220
    Uniprot Entry Name RGS2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000116741
    Target Classification Not Available

    Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. The protein acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. [provided by RefSeq, Aug 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.