Human SCGN/CALBL/ DJ501N12.8 ORF/cDNA clone-Lentivirus particle (NM_006998)

Pre-made Human SCGN/CALBL/ DJ501N12.8 Lentiviral expression plasmid for SCGN lentivirus packaging, SCGN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SCGN/CALBL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002186 Human SCGN Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002186
Gene Name SCGN
Accession Number NM_006998
Gene ID 10590
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 831 bp
Gene Alias CALBL, DJ501N12.8, SECRET, SEGN, setagin
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACAGCTCCCGGGAACCGACTCTGGGGCGCTTGGACGCCGCTGGCTTCTGGCAGGTCTGGCAGCGCTTTGATGCGGATGAAAAAGGTTACATAGAAGAGAAGGAACTCGATGCTTTCTTTCTCCACATGTTGATGAAACTGGGTACTGATGACACGGTCATGAAAGCAAATTTGCACAAGGTGAAACAGCAGTTTATGACTACCCAAGATGCCTCTAAAGATGGTCGCATTCGGATGAAAGAGCTTGCTGGTATGTTCTTATCTGAGGATGAAAACTTTCTTCTGCTCTTTCGCCGGGAAAACCCACTGGACAGCAGCGTGGAGTTTATGCAGATTTGGCGCAAATATGACGCTGACAGCAGTGGCTTTATATCAGCTGCTGAGCTCCGCAACTTCCTCCGAGACCTCTTTCTTCACCACAAAAAGGCCATTTCTGAGGCTAAACTGGAAGAATACACTGGCACCATGATGAAGATTTTTGACAGAAATAAAGATGGTCGGTTGGATCTAAATGACTTAGCAAGGATTCTGGCTCTTCAGGAAAACTTCCTTCTCCAATTTAAAATGGATGCTTGTTCTACTGAAGAAAGGAAAAGGGACTTTGAGAAAATCTTTGCCTACTATGATGTTAGTAAAACAGGAGCCCTGGAAGGCCCAGAAGTGGATGGGTTTGTCAAAGACATGATGGAGCTTGTCCAGCCCAGCATCAGCGGGGTGGACCTTGATAAGTTCCGCGAGATTCTCCTGCGTCACTGCGACGTGAACAAGGATGGAAAAATTCAGAAGTCTGAGCTGGCTTTGTGTCTTGGGCTGAAAATCAACCCATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1422-Ab Anti-SEGN/ SCGN/ CALBL functional antibody
    Target Antigen GM-Tg-g-SE1422-Ag SCGN protein
    ORF Viral Vector pGMLP002186 Human SCGN Lentivirus plasmid
    ORF Viral Vector vGMLP002186 Human SCGN Lentivirus particle


    Target information

    Target ID GM-SE1422
    Target Name SCGN
    Gene ID 10590, 214189, 694072, 306942, 101097064, 610954, 618206, 100067986
    Gene Symbol and Synonyms CALBL,DJ501N12.8,SCGN,SECRET,SEGN,setagin
    Uniprot Accession O76038
    Uniprot Entry Name SEGN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000079689
    Target Classification Not Available

    The encoded protein is a secreted calcium-binding protein which is found in the cytoplasm. It is related to calbindin D-28K and calretinin. This protein is thought to be involved in KCL-stimulated calcium flux and cell proliferation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.