Human TUBA1A/B-ALPHA-1/LIS3 ORF/cDNA clone-Lentivirus particle (NM_006009)

Cat. No.: vGMLP002253

Pre-made Human TUBA1A/B-ALPHA-1/LIS3 Lentiviral expression plasmid for TUBA1A lentivirus packaging, TUBA1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TUBA1A/B-ALPHA-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002253 Human TUBA1A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002253
Gene Name TUBA1A
Accession Number NM_006009
Gene ID 7846
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1356 bp
Gene Alias B-ALPHA-1,LIS3,TUBA3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATTGGCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCAAGTGACAAGACCATTGGGGGAGGAGATGATTCCTTCAACACCTTCTTCAGTGAGACGGGGGCTGGCAAGCATGTGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAACTTATCACAGGCAAAGAAGATGCTGCCAATAACTATGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCTCGTGTTGGACCGAATTCGCAAGCTGGCCGACCAGTGCACGGGTCTCCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCGCTGCTCATGGAACGTCTCTCAGTTGATTATGGCAAGAAGTCCAAGCTGGAGTTCTCTATTTACCCGGCGCCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTCGTAGAAACCTCGATATTGAGCGTCCAACCTATACTAACCTGAATAGGTTAATAGGTCAAATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGATGGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTATCCCCGCATCCACTTCCCTCTGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCACCAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAGACCAAGCGTACCATCCAGTTTGTGGATTGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGTGGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAACGTGCCTTTGTTCACTGGTACGTTGGGGAGGGGATGGAGGAAGGTGAGTTTTCAGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAA
ORF Protein Sequence MRECISIHVGQAGVQIGNACWELYCLEHGIQPDGQMPSDKTIGGGDDSFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGTYRQLFHPEQLITGKEDAANNYARGHYTIGKEIIDLVLDRIRKLADQCTGLQGFLVFHSFGGGTGSGFTSLLMERLSVDYGKKSKLEFSIYPAPQVSTAVVEPYNSILTTHTTLEHSDCAFMVDNEAIYDICRRNLDIERPTYTNLNRLIGQIVSSITASLRFDGALNVDLTEFQTNLVPYPRIHFPLATYAPVISAEKAYHEQLSVAEITNACFEPANQMVKCDPRHGKYMACCLLYRGDVVPKDVNAAIATIKTKRTIQFVDWCPTGFKVGINYQPPTVVPGGDLAKVQRAVCMLSNTTAIAEAWARLDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDMAALEKDYEEVGVDSVEGEGEEEGEEY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA062-Ab Anti-TUBA1A monoclonal antibody
    Target Antigen GM-Tg-g-TA062-Ag TUBA1A protein
    ORF Viral Vector pGMLP002253 Human TUBA1A Lentivirus plasmid
    ORF Viral Vector vGMLP002253 Human TUBA1A Lentivirus particle


    Target information

    Target ID GM-TA062
    Target Name TUBA1A
    Gene ID 7846, 22142, 574194, 64158, 101096902, 100051840
    Gene Symbol and Synonyms B-ALPHA-1,LIS3,Tuba-1,Tuba1,TUBA1A,TUBA3
    Uniprot Accession Q71U36
    Uniprot Entry Name TBA1A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000167552
    Target Classification Not Available

    Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.