Human LYZ/LYZF1/LZM ORF/cDNA clone-Lentivirus particle (NM_000239)

Cat. No.: vGMLP002308

Pre-made Human LYZ/LYZF1/LZM Lentiviral expression plasmid for LYZ lentivirus packaging, LYZ lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LYZ/LYZF1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002308 Human LYZ Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002308
Gene Name LYZ
Accession Number NM_000239
Gene ID 4069
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 447 bp
Gene Alias LYZF1,LZM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGCTCTCATTGTTCTGGGGCTTGTCCTCCTTTCTGTTACGGTCCAGGGCAAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGTTACAACACACGAGCTACAAACTACAATGCTGGAGACAGAAGCACTGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTTATCCTGCAGTGCTTTGCTGCAAGATAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGTTGTCCGTGATCCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCGTTGTCAAAACAGAGATGTCCGTCAGTATGTTCAAGGTTGTGGAGTGTAA
ORF Protein Sequence MKALIVLGLVLLSVTVQGKVFERCELARTLKRLGMDGYRGISLANWMCLAKWESGYNTRATNYNAGDRSTDYGIFQINSRYWCNDGKTPGAVNACHLSCSALLQDNIADAVACAKRVVRDPQGIRAWVAWRNRCQNRDVRQYVQGCGV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T10586-Ab Anti-LYSC/ LYZ/ LYZF1 functional antibody
    Target Antigen GM-Tg-g-T10586-Ag LYZ protein
    ORF Viral Vector pGMLP002308 Human LYZ Lentivirus plasmid
    ORF Viral Vector vGMLP002308 Human LYZ Lentivirus particle


    Target information

    Target ID GM-T10586
    Target Name LYZ
    Gene ID 4069, 718361, 100127109, 474442, 100052143
    Gene Symbol and Synonyms LYZ,LYZF1,LYZF2,LZM
    Uniprot Accession P61626
    Uniprot Entry Name LYSC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000090382
    Target Classification Not Available

    This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.