Human LYZ/LYZF1/LZM ORF/cDNA clone-Lentivirus particle (NM_000239)
Cat. No.: vGMLP002308
Pre-made Human LYZ/LYZF1/LZM Lentiviral expression plasmid for LYZ lentivirus packaging, LYZ lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
LYZ/LYZF1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002308 | Human LYZ Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002308 |
| Gene Name | LYZ |
| Accession Number | NM_000239 |
| Gene ID | 4069 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 447 bp |
| Gene Alias | LYZF1,LZM |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGGCTCTCATTGTTCTGGGGCTTGTCCTCCTTTCTGTTACGGTCCAGGGCAAGGTCTTTGAAAGGTGTGAGTTGGCCAGAACTCTGAAAAGATTGGGAATGGATGGCTACAGGGGAATCAGCCTAGCAAACTGGATGTGTTTGGCCAAATGGGAGAGTGGTTACAACACACGAGCTACAAACTACAATGCTGGAGACAGAAGCACTGATTATGGGATATTTCAGATCAATAGCCGCTACTGGTGTAATGATGGCAAAACCCCAGGAGCAGTTAATGCCTGTCATTTATCCTGCAGTGCTTTGCTGCAAGATAACATCGCTGATGCTGTAGCTTGTGCAAAGAGGGTTGTCCGTGATCCACAAGGCATTAGAGCATGGGTGGCATGGAGAAATCGTTGTCAAAACAGAGATGTCCGTCAGTATGTTCAAGGTTGTGGAGTGTAA |
| ORF Protein Sequence | MKALIVLGLVLLSVTVQGKVFERCELARTLKRLGMDGYRGISLANWMCLAKWESGYNTRATNYNAGDRSTDYGIFQINSRYWCNDGKTPGAVNACHLSCSALLQDNIADAVACAKRVVRDPQGIRAWVAWRNRCQNRDVRQYVQGCGV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T10586-Ab | Anti-LYSC/ LYZ/ LYZF1 functional antibody |
| Target Antigen | GM-Tg-g-T10586-Ag | LYZ protein |
| ORF Viral Vector | pGMLP002308 | Human LYZ Lentivirus plasmid |
| ORF Viral Vector | vGMLP002308 | Human LYZ Lentivirus particle |
Target information
| Target ID | GM-T10586 |
| Target Name | LYZ |
| Gene ID | 4069, 718361, 100127109, 474442, 100052143 |
| Gene Symbol and Synonyms | LYZ,LYZF1,LYZF2,LZM |
| Uniprot Accession | P61626 |
| Uniprot Entry Name | LYSC_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000090382 |
| Target Classification | Not Available |
This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis. [provided by RefSeq, Oct 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


