Human RGS6/GAP/HA117 ORF/cDNA clone-Lentivirus particle (NM_004296)

Cat. No.: vGMLP002453

Pre-made Human RGS6/GAP/HA117 Lentiviral expression plasmid for RGS6 lentivirus packaging, RGS6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RGS6/GAP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002453 Human RGS6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002453
Gene Name RGS6
Accession Number NM_004296
Gene ID 9628
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1419 bp
Gene Alias GAP,HA117,S914
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCAAGGATCCGGGGATCAAAGAGCAGTGGGGGTTGCTGACCCAGAGGAGAGTTCTCCAAACATGATCGTTTACTGCAAAATTGAAGACATCATTACAAAGATGCAAGATGACAAGACAGGGGGTGTGCCCATCAGAACAGTCAAGAGCTTTCTCTCCAAAATCCCCAGTGTCGTCACAGGTACTGACATTGTGCAGTGGCTTATGAAGAACCTTTCCATTGAGGACCCAGTTGAAGCAATACACTTGGGGAGCCTTATCGCTGCCCAGGGCTACATCTTTCCAATCTCAGACCATGTTCTCACCATGAAGGATGATGGCACCTTTTATCGTTTCCAGGCTCCGTACTTCTGGCCTTCGAACTGCTGGGAACCTGAAAACACTGACTATGCCATCTATCTCTGTAAGAGGACAATGCAAAATAAAGCAAGGCTGGAACTGGCAGATTATGAAGCAGAAAACTTAGCAAGACTCCAGAGGGCCTTTGCGAGGAAGTGGGAATTCATCTTTATGCAAGCAGAAGCACAAGTAAAGATTGACCGGAAAAAAGACAAGACAGAAAGGAAAATTTTGGATAGTCAAGAACGAGCCTTTTGGGATGTCCACAGGCCTGTGCCAGGCTGTGTGAACACAACAGAAATGGATATCCGAAAATGTCGACGTTTGAAGAATCCACAAAAGGTTAAAAAGTCCGTGTATGGCGTGACTGAAGAGTCCCAGGCACAGAGCCCGGTGCATGTACTCAGCCAACCAATCAGGAAAACAACAAAAGAGGACATCCGGAAACAGATAACATTTTTGAACGCACAGATCGACAGACATTGTTTGAAAATGTCCAAAGTGGCTGAAAGTTTAATTGCCTACACGGAACAATATGTGGAATATGACCCTTTGATAACACCAGCTGAGCCATCCAACCCTTGGATCAGCGATGACGTTGCTTTGTGGGACATAGAGATGAGCAAAGAGCCCAGCCAACAGCGAGTAAAAAGATGGGGCTTCTCTTTCGATGAGATATTGAAGGACCAGGTGGGGCGGGACCAGTTTCTACGATTCCTGGAGTCCGAATTCAGTTCAGAAAACCTCAGGTTCTGGCTGGCTGTCCAAGATCTTAAGAAACAACCCCTACAGGATGTGGCCAAGAGGGTAGAAGAAATCTGGCAAGAGTTTCTGGCTCCAGGGGCTCCAAGTGCAATCAACCTGGATTCTCACAGCTATGAGATAACCAGTCAAAATGTCAAAGATGGAGGGAGATATACATTTGAAGACGCCCAGGAGCACATCTACAAGCTGATGAAGAGTGACAGCTATGCCCGCTTCCTCCGGTCAAATGCTTACCAGGATTTGCTGCTGGCCAAGAAGAAGGGAAAGTCGCTGGCGGGCAAGCGCCTCACGGGCCTGATGCAGTCCTCCTGA
ORF Protein Sequence MAQGSGDQRAVGVADPEESSPNMIVYCKIEDIITKMQDDKTGGVPIRTVKSFLSKIPSVVTGTDIVQWLMKNLSIEDPVEAIHLGSLIAAQGYIFPISDHVLTMKDDGTFYRFQAPYFWPSNCWEPENTDYAIYLCKRTMQNKARLELADYEAENLARLQRAFARKWEFIFMQAEAQVKIDRKKDKTERKILDSQERAFWDVHRPVPGCVNTTEMDIRKCRRLKNPQKVKKSVYGVTEESQAQSPVHVLSQPIRKTTKEDIRKQITFLNAQIDRHCLKMSKVAESLIAYTEQYVEYDPLITPAEPSNPWISDDVALWDIEMSKEPSQQRVKRWGFSFDEILKDQVGRDQFLRFLESEFSSENLRFWLAVQDLKKQPLQDVAKRVEEIWQEFLAPGAPSAINLDSHSYEITSQNVKDGGRYTFEDAQEHIYKLMKSDSYARFLRSNAYQDLLLAKKKGKSLAGKRLTGLMQSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T33909-Ab Anti-RGS6 monoclonal antibody
    Target Antigen GM-Tg-g-T33909-Ag RGS6 protein
    ORF Viral Vector pGMLP002453 Human RGS6 Lentivirus plasmid
    ORF Viral Vector vGMLP002453 Human RGS6 Lentivirus particle


    Target information

    Target ID GM-T33909
    Target Name RGS6
    Gene ID 9628, 50779, 694620, 54295, 101083183, 480380, 517545, 100055109
    Gene Symbol and Synonyms GAP,HA117,RGS6,S914
    Uniprot Accession P49758
    Uniprot Entry Name RGS6_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000182732
    Target Classification Not Available

    This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP and GGL domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Many alternatively spliced transcript variants encoding different isoforms with long or short N-terminal domains, complete or incomplete GGL domains, and distinct C-terminal domains, have been described for this gene, however, the full-length nature of some of these variants is not known.[provided by RefSeq, Mar 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.