Human MGARP/C4orf49/CESP-1 ORF/cDNA clone-Lentivirus particle (NM_032623)

Cat. No.: vGMLP002584

Pre-made Human MGARP/C4orf49/CESP-1 Lentiviral expression plasmid for MGARP lentivirus packaging, MGARP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MGARP/C4orf49 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002584 Human MGARP Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002584
Gene Name MGARP
Accession Number NM_032623
Gene ID 84709
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 723 bp
Gene Alias C4orf49,CESP-1,HUMMR,OSAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTATCTCCGCAGGGCGGTCTCCAAGACTCTGGCGCTGCCGCTGAGGGCGCCCCCCAACCCCGCGCCGCTCGGAAAGGACGCATCTCTGCGCCGGATGTCATCTAACAGATTCCCTGGATCATCTGGATCAAATATGATTTATTATCTGGTTGTAGGCGTCACAGTCAGTGCTGGTGGATATTATGCTTACAAGACAGTCACATCAGACCAAGCCAAACACACAGAACATAAAACAAATTTGAAAGAAAAAACAAAAGCAGAGATACATCCATTTCAAGGTGAAAAGGAGAATGTTGCGGAAACTGAGAAAGCAAGTTCAGAAGCCCCAGAAGAACTTATAGTGGAAGCTGAGGTGGTAGATGCTGAAGAAAGTCCCAGTGCTACAGTTGTGGTCATAAAAGAGGCATCTGCCTGTCCAGGTCACGTGGAGGCTGCTCCGGAGACCACAGCAGTCAGTGCTGAAACCGGGCCAGAGGTCACAGATGCAGCGGCGAGGGAAACCACGGAAGTAAACCCTGAAACAACCCCAGAGGTTACAAATGCTGCCCTGGATGAAGCTGTCACCATCGATAATGATAAAGATACAACAAAGAACGAAACCTCTGATGAATATGCTGAACTAGAAGAAGAAAATTCTCCAGCTGAGTCAGAGTCCTCTGCTGGAGATGATTTACAGGAGGAAGCCAGTGTTGGCTCTGAGGCTGCTTCGGCTCAAGGCTAA
ORF Protein Sequence MYLRRAVSKTLALPLRAPPNPAPLGKDASLRRMSSNRFPGSSGSNMIYYLVVGVTVSAGGYYAYKTVTSDQAKHTEHKTNLKEKTKAEIHPFQGEKENVAETEKASSEAPEELIVEAEVVDAEESPSATVVVIKEASACPGHVEAAPETTAVSAETGPEVTDAAARETTEVNPETTPEVTNAALDEAVTIDNDKDTTKNETSDEYAELEEENSPAESESSAGDDLQEEASVGSEAASAQG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1185-Ab Anti-MGARP monoclonal antibody
    Target Antigen GM-Tg-g-IP1185-Ag MGARP protein
    ORF Viral Vector pGMLP002584 Human MGARP Lentivirus plasmid
    ORF Viral Vector vGMLP002584 Human MGARP Lentivirus particle


    Target information

    Target ID GM-IP1185
    Target Name MGARP
    Gene ID 84709, 67749, 697003, 689931, 101098627, 607964, 513234, 100063365
    Gene Symbol and Synonyms 4930583H14Rik,C17H4orf49,C19H4orf49,C4orf49,C5H4orf49,CESP-1,HUMMR,MGARP,OSAP,Qsap
    Uniprot Accession Q8TDB4
    Uniprot Entry Name HUMMR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000137463
    Target Classification Not Available

    Predicted to be involved in several processes, including axonal transport; cellular response to hormone stimulus; and protein targeting to mitochondrion. Located in mitochondrion. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.