Human CREB1/CREB/ CREB-1 ORF/cDNA clone-Lentivirus particle (NM_134442)

Pre-made Human CREB1/CREB/ CREB-1 Lentiviral expression plasmid for CREB1 lentivirus packaging, CREB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CREB1/CREB products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002666 Human CREB1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002666
Gene Name CREB1
Accession Number NM_134442
Gene ID 1385
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1026 bp
Gene Alias CREB, CREB-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCTGAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCTATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAATGGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCTCCACAAGTCCAAACAGTTCAGTCTTCCTGTAAGGACTTAAAAAGACTTTTCTCCGGAACACAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGATTCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGGGAAGCAGCTCGAGAGTGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGCTTGAAAATCAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCAGATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92098-Ab Anti-CREB1 monoclonal antibody
    Target Antigen GM-Tg-g-T92098-Ag CREB1 protein
    ORF Viral Vector pGMLV000036 Rat Creb1 Lentivirus plasmid
    ORF Viral Vector pGMAAV000665 Rat Creb1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC001174 Human CREB1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002666 Human CREB1 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-130 Human CREB1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-270 Human CREB1 Adenovirus plasmid
    ORF Viral Vector vGMLV000036 Rat Creb1 Lentivirus particle
    ORF Viral Vector vGMAAV000665 Rat Creb1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002666 Human CREB1 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-130 Human CREB1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-270 Human CREB1 Adenovirus particle
    ORF Viral Vector pGMLV002125 Mouse Creb1 Lentivirus plasmid


    Target information

    Target ID GM-T92098
    Target Name CREB1
    Gene ID 1385, 12912, 708717, 81646, 101091299, 607922, 281713, 100066388
    Gene Symbol and Synonyms 2310001E10Rik,3526402H21Rik,CREB,CREB-1,CREB1
    Uniprot Accession P16220
    Uniprot Entry Name CREB1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000118260
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.