Human CREB1/CREB/ CREB-1 ORF/cDNA clone-Lentivirus particle (NM_134442)
Pre-made Human CREB1/CREB/ CREB-1 Lentiviral expression plasmid for CREB1 lentivirus packaging, CREB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CREB1/CREB products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002666 | Human CREB1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002666 |
Gene Name | CREB1 |
Accession Number | NM_134442 |
Gene ID | 1385 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1026 bp |
Gene Alias | CREB, CREB-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCTGAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCTATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAATGGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCTCCACAAGTCCAAACAGTTCAGTCTTCCTGTAAGGACTTAAAAAGACTTTTCTCCGGAACACAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGATTCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGGGAAGCAGCTCGAGAGTGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGCTTGAAAATCAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCAGATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T92098-Ab | Anti-CREB1 monoclonal antibody |
Target Antigen | GM-Tg-g-T92098-Ag | CREB1 protein |
ORF Viral Vector | pGMLV000036 | Rat Creb1 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000665 | Rat Creb1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC001174 | Human CREB1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002666 | Human CREB1 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-130 | Human CREB1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-270 | Human CREB1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000036 | Rat Creb1 Lentivirus particle |
ORF Viral Vector | vGMAAV000665 | Rat Creb1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP002666 | Human CREB1 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-130 | Human CREB1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-270 | Human CREB1 Adenovirus particle |
ORF Viral Vector | pGMLV002125 | Mouse Creb1 Lentivirus plasmid |
Target information
Target ID | GM-T92098 |
Target Name | CREB1 |
Gene ID | 1385, 12912, 708717, 81646, 101091299, 607922, 281713, 100066388 |
Gene Symbol and Synonyms | 2310001E10Rik,3526402H21Rik,CREB,CREB-1,CREB1 |
Uniprot Accession | P16220 |
Uniprot Entry Name | CREB1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000118260 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.