Human CRH/CRF/CRH1 ORF/cDNA clone-Lentivirus particle (NM_000756)

Cat. No.: vGMLP002742

Pre-made Human CRH/CRF/CRH1 Lentiviral expression plasmid for CRH lentivirus packaging, CRH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CRH/CRF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002742 Human CRH Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002742
Gene Name CRH
Accession Number NM_000756
Gene ID 1392
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 591 bp
Gene Alias CRF,CRH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGCTGCCGCTGCTTGTGTCCGCGGGAGTCCTGCTGGTGGCTCTCCTGCCCTGCCCGCCATGCAGGGCGCTCCTGAGCCGCGGGCCGGTCCCGGGAGCTCGGCAGGCGCCGCAGCACCCTCAGCCCTTGGATTTCTTCCAGCCGCCGCCGCAGTCCGAGCAGCCCCAGCAGCCGCAGGCTCGGCCGGTCCTGCTCCGCATGGGAGAGGAGTACTTCCTCCGCCTGGGGAACCTCAACAAGAGCCCGGCCGCTCCCCTTTCGCCCGCCTCCTCGCTCCTCGCCGGAGGCAGCGGCAGCCGCCCTTCGCCGGAACAGGCGACCGCCAACTTTTTCCGCGTGTTGCTGCAGCAGCTGCTGCTGCCTCGGCGCTCGCTCGACAGCCCCGCGGCTCTCGCGGAGCGCGGCGCTAGGAATGCCCTCGGCGGCCACCAGGAGGCACCGGAGAGAGAAAGGCGGTCCGAGGAGCCTCCCATCTCCCTGGATCTCACCTTCCACCTCCTCCGGGAAGTCTTGGAAATGGCCAGGGCCGAGCAGTTAGCACAGCAAGCTCACAGCAACAGGAAACTCATGGAGATTATTGGGAAATAA
ORF Protein Sequence MRLPLLVSAGVLLVALLPCPPCRALLSRGPVPGARQAPQHPQPLDFFQPPPQSEQPQQPQARPVLLRMGEEYFLRLGNLNKSPAAPLSPASSLLAGGSGSRPSPEQATANFFRVLLQQLLLPRRSLDSPAALAERGARNALGGHQEAPERERRSEEPPISLDLTFHLLREVLEMARAEQLAQQAHSNRKLMEIIGK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T64137-Ab Anti-CRF/ CRH/ CRF1 functional antibody
    Target Antigen GM-Tg-g-T64137-Ag CRH protein
    ORF Viral Vector pGMLP002742 Human CRH Lentivirus plasmid
    ORF Viral Vector vGMLP002742 Human CRH Lentivirus particle


    Target information

    Target ID GM-T64137
    Target Name CRH
    Gene ID 1392, 12918, 702877, 81648, 692345, 486977, 280755, 100063840
    Gene Symbol and Synonyms CRF,CRH,CRH1,Gm1347
    Uniprot Accession P06850
    Uniprot Entry Name CRF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000147571
    Target Classification Not Available

    This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.