Human CRH/CRF/CRH1 ORF/cDNA clone-Lentivirus particle (NM_000756)
Cat. No.: vGMLP002742
Pre-made Human CRH/CRF/CRH1 Lentiviral expression plasmid for CRH lentivirus packaging, CRH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CRH/CRF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP002742 | Human CRH Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP002742 |
| Gene Name | CRH |
| Accession Number | NM_000756 |
| Gene ID | 1392 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 591 bp |
| Gene Alias | CRF,CRH1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCGGCTGCCGCTGCTTGTGTCCGCGGGAGTCCTGCTGGTGGCTCTCCTGCCCTGCCCGCCATGCAGGGCGCTCCTGAGCCGCGGGCCGGTCCCGGGAGCTCGGCAGGCGCCGCAGCACCCTCAGCCCTTGGATTTCTTCCAGCCGCCGCCGCAGTCCGAGCAGCCCCAGCAGCCGCAGGCTCGGCCGGTCCTGCTCCGCATGGGAGAGGAGTACTTCCTCCGCCTGGGGAACCTCAACAAGAGCCCGGCCGCTCCCCTTTCGCCCGCCTCCTCGCTCCTCGCCGGAGGCAGCGGCAGCCGCCCTTCGCCGGAACAGGCGACCGCCAACTTTTTCCGCGTGTTGCTGCAGCAGCTGCTGCTGCCTCGGCGCTCGCTCGACAGCCCCGCGGCTCTCGCGGAGCGCGGCGCTAGGAATGCCCTCGGCGGCCACCAGGAGGCACCGGAGAGAGAAAGGCGGTCCGAGGAGCCTCCCATCTCCCTGGATCTCACCTTCCACCTCCTCCGGGAAGTCTTGGAAATGGCCAGGGCCGAGCAGTTAGCACAGCAAGCTCACAGCAACAGGAAACTCATGGAGATTATTGGGAAATAA |
| ORF Protein Sequence | MRLPLLVSAGVLLVALLPCPPCRALLSRGPVPGARQAPQHPQPLDFFQPPPQSEQPQQPQARPVLLRMGEEYFLRLGNLNKSPAAPLSPASSLLAGGSGSRPSPEQATANFFRVLLQQLLLPRRSLDSPAALAERGARNALGGHQEAPERERRSEEPPISLDLTFHLLREVLEMARAEQLAQQAHSNRKLMEIIGK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T64137-Ab | Anti-CRF/ CRH/ CRF1 functional antibody |
| Target Antigen | GM-Tg-g-T64137-Ag | CRH protein |
| ORF Viral Vector | pGMLP002742 | Human CRH Lentivirus plasmid |
| ORF Viral Vector | vGMLP002742 | Human CRH Lentivirus particle |
Target information
| Target ID | GM-T64137 |
| Target Name | CRH |
| Gene ID | 1392, 12918, 702877, 81648, 692345, 486977, 280755, 100063840 |
| Gene Symbol and Synonyms | CRF,CRH,CRH1,Gm1347 |
| Uniprot Accession | P06850 |
| Uniprot Entry Name | CRF_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000147571 |
| Target Classification | Not Available |
This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


