Human CXCL3/CINC-2b/ GRO3 ORF/cDNA clone-Lentivirus particle (NM_002090)

Pre-made Human CXCL3/CINC-2b/ GRO3 Lentiviral expression plasmid for CXCL3 lentivirus packaging, CXCL3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CXCL3/CINC-2b products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002748 Human CXCL3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002748
Gene Name CXCL3
Accession Number NM_002090
Gene ID 2921
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 324 bp
Gene Alias CINC-2b, GRO3, GROg, MIP-2b, MIP2B, SCYB3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCACGCCACGCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGGGTGGCGCTGCTGCTCCTGCTCCTGGTGGCCGCCAGCCGGCGCGCAGCAGGAGCGTCCGTGGTCACTGAACTGCGCTGCCAGTGCTTGCAGACACTGCAGGGAATTCACCTCAAGAACATCCAAAGTGTGAATGTAAGGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGAAGAAAGCTTGTCTCAACCCCGCATCCCCCATGGTTCAGAAAATCATCGAAAAGATACTGAACAAGGGGAGCACCAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0843-Ab Anti-CXCL3/ CINC-2b/ GRO3 functional antibody
    Target Antigen GM-Tg-g-SE0843-Ag CXCL3 protein
    Cytokine cks-Tg-g-GM-SE0843 chemokine (C-X-C motif) ligand 3 (CXCL3) protein & antibody
    ORF Viral Vector pGMLP002748 Human CXCL3 Lentivirus plasmid
    ORF Viral Vector vGMLP002748 Human CXCL3 Lentivirus particle


    Target information

    Target ID GM-SE0843
    Target Name CXCL3
    Gene ID 2921
    Gene Symbol and Synonyms CINC-2b,CXCL3,GRO3,GROg,MIP-2b,MIP2B,SCYB3
    Uniprot Accession P19876
    Uniprot Entry Name CXCL3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000163734
    Target Classification Not Available

    This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.