Human TNNI2/AMCD2B/DA2B ORF/cDNA clone-Lentivirus particle (NM_003282)

Cat. No.: vGMLP002826

Pre-made Human TNNI2/AMCD2B/DA2B Lentiviral expression plasmid for TNNI2 lentivirus packaging, TNNI2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TNNI2/AMCD2B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002826 Human TNNI2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002826
Gene Name TNNI2
Accession Number NM_003282
Gene ID 7136
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 549 bp
Gene Alias AMCD2B,DA2B,FSSV,fsTnI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGAGATGAGGAGAAGCGGAACAGGGCCATCACGGCCCGCAGGCAGCACCTGAAGAGTGTGATGCTGCAGATAGCGGCCACGGAGCTGGAGAAGGAGGAGAGCCGCCGTGAGGCAGAGAAGCAGAACTACCTGGCGGAGCACTGCCCGCCGCTGCATATCCCGGGCTCCATGTCTGAAGTGCAGGAGCTCTGCAAACAGCTGCACGCCAAGATCGATGCGGCTGAAGAGGAGAAGTACGACATGGAGGTGAGGGTGCAGAAGACCAGCAAGGAGCTGGAGGACATGAACCAGAAGCTATTTGATCTGCGGGGCAAGTTCAAGCGGCCCCCACTGCGGAGGGTGCGCATGTCGGCCGATGCCATGCTCAAGGCCCTGCTGGGCTCGAAGCACAAGGTGTGCATGGACCTGAGGGCCAACCTGAAGCAGGTCAAGAAGGAGGACACAGAGAAGGAGCGGGACCTGCGAGACGTGGGTGACTGGAGGAAGAACATCGAGGAGAAGTCTGGCATGGAGGGCCGGAAGAAGATGTTTGAGTCCGAGTCCTAG
ORF Protein Sequence MGDEEKRNRAITARRQHLKSVMLQIAATELEKEESRREAEKQNYLAEHCPPLHIPGSMSEVQELCKQLHAKIDAAEEEKYDMEVRVQKTSKELEDMNQKLFDLRGKFKRPPLRRVRMSADAMLKALLGSKHKVCMDLRANLKQVKKEDTEKERDLRDVGDWRKNIEEKSGMEGRKKMFESES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0250-Ab Anti-TNNI2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0250-Ag TNNI2 protein
    ORF Viral Vector pGMLP002826 Human TNNI2 Lentivirus plasmid
    ORF Viral Vector vGMLP002826 Human TNNI2 Lentivirus particle


    Target information

    Target ID GM-IP0250
    Target Name TNNI2
    Gene ID 7136, 21953, 721041, 29389, 102901941, 475995, 506434, 106781214
    Gene Symbol and Synonyms AMCD2B,DA2B,DA2B1,FSSV,fsTnI,TNNI2
    Uniprot Accession P48788
    Uniprot Entry Name TNNI2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000130598
    Target Classification Not Available

    This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.