Human CYP21A2/CA21H/ CAH1 ORF/cDNA clone-Lentivirus particle (NM_000500)

Pre-made Human CYP21A2/CA21H/ CAH1 Lentiviral expression plasmid for CYP21A2 lentivirus packaging, CYP21A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CYP21A2/CA21H products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002839 Human CYP21A2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002839
Gene Name CYP21A2
Accession Number NM_000500
Gene ID 1589
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1488 bp
Gene Alias CA21H, CAH1, CPS1, CYP21, CYP21B, P450c21B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCTCCTGGGCCTGCTGCTGCTGCTGCCCCTGCTGGCTGGCGCCCGCCTGCTGTGGAACTGGTGGAAGCTCCGGAGCCTCCACCTCCCGCCTCTTGCCCCGGGCTTCTTGCACCTGCTGCAGCCCGACCTCCCCATCTATCTGCTTGGCCTGACTCAGAAATTCGGGCCCATCTACAGGCTCCACCTTGGGCTGCAAGATGTGGTGGTGCTGAACTCCAAGAGGACCATTGAGGAAGCCATGGTCAAAAAGTGGGCAGACTTTGCTGGCAGACCTGAGCCACTTACCTACAAGCTGGTGTCTAGGAACTACCCGGACCTGTCCTTGGGAGACTACTCCCTGCTCTGGAAAGCCCACAAGAAGCTCACCCGCTCAGCCCTGCTGCTGGGCATCCGTGACTCCATGGAGCCAGTGGTGGAGCAGCTGACCCAGGAGTTCTGTGAGCGCATGAGAGCCCAGCCCGGCACCCCTGTGGCCATTGAGGAGGAATTCTCTCTCCTCACCTGCAGCATCATCTGTTACCTCACCTTCGGAGACAAGATCAAGGACGACAACTTAATGCCTGCCTATTACAAATGTATCCAGGAGGTGTTAAAAACCTGGAGCCACTGGTCCATCCAAATTGTGGACGTGATTCCCTTTCTCAGGTTCTTCCCCAATCCAGGTCTCCGGAGGCTGAAGCAGGCCATAGAGAAGAGGGATCACATCGTGGAGATGCAGCTGAGGCAGCACAAGGAGAGCCTCGTGGCAGGCCAGTGGAGGGACATGATGGACTACATGCTCCAAGGGGTGGCGCAGCCGAGCATGGAAGAGGGCTCTGGACAGCTCCTGGAAGGGCACGTGCACATGGCTGCAGTGGACCTCCTGATCGGTGGCACTGAGACCACAGCAAACACCCTCTCCTGGGCCGTGGTTTTTTTGCTTCACCACCCTGAGATTCAGCAGCGACTGCAGGAGGAGCTAGACCACGAACTGGGCCCTGGTGCCTCCAGCTCCCGGGTCCCCTACAAGGACCGTGCACGGCTGCCCTTGCTCAATGCCACCATCGCCGAGGTGCTGCGCCTGCGGCCCGTTGTGCCCTTAGCCTTGCCCCACCGCACCACACGGCCCAGCAGCATCTCCGGCTACGACATCCCTGAGGGCACAGTCATCATTCCGAACCTCCAAGGCGCCCACCTGGATGAGACGGTCTGGGAGAGGCCACATGAGTTCTGGCCTGATCGCTTCCTGGAGCCAGGCAAGAACTCCAGAGCTCTGGCCTTCGGCTGCGGTGCCCGCGTGTGCCTGGGCGAGCCGCTGGCGCGCCTGGAGCTCTTCGTGGTGCTGACCCGACTGCTGCAGGCCTTCACGCTGCTGCCCTCCGGGGACGCCCTGCCCTCCCTGCAGCCCCTGCCCCACTGCAGTGTCATCCTCAAGATGCAGCCTTTCCAAGTGCGGCTGCAGCCCCGGGGGATGGGGGCCCACAGCCCGGGCCAGAGCCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1661-Ab Anti-CP21A/ CYP21A2/ CA21H functional antibody
    Target Antigen GM-Tg-g-SE1661-Ag CYP21A2 protein
    ORF Viral Vector pGMLP002839 Human CYP21A2 Lentivirus plasmid
    ORF Viral Vector vGMLP002839 Human CYP21A2 Lentivirus particle


    Target information

    Target ID GM-SE1661
    Target Name CYP21A2
    Gene ID 1589, 13079, 717020, 24298, 101094596, 415124, 281741, 100059277
    Gene Symbol and Synonyms 21-OH,21-OHase,21OH,21OHA,21OHB,CA21H,CAH1,CPS1,CYP21,Cyp21-ps1,CYP21A,Cyp21a1,CYP21A2,Cyp21a2-ps,Cyp21a2ps,CYP21B,CYP21OH-A,Oh21-1,Oh21-2,P450c21B
    Uniprot Accession P08686
    Uniprot Entry Name CP21A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000231852
    Target Classification Not Available

    This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.