Human CA2/CA-II/ CAC ORF/cDNA clone-Lentivirus particle (NM_000067)

Pre-made Human CA2/CA-II/ CAC Lentiviral expression plasmid for CA2 lentivirus packaging, CA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CA-II/CA2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002928 Human CA2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002928
Gene Name CA2
Accession Number NM_000067
Gene ID 760
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 783 bp
Gene Alias CA-II, CAC, CAII, Car2, HEL-76, HEL-S-282
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCCATCACTGGGGGTACGGCAAACACAACGGACCTGAGCACTGGCATAAGGACTTCCCCATTGCCAAGGGAGAGCGCCAGTCCCCTGTTGACATCGACACTCATACAGCCAAGTATGACCCTTCCCTGAAGCCCCTGTCTGTTTCCTATGATCAAGCAACTTCCCTGAGGATCCTCAACAATGGTCATGCTTTCAACGTGGAGTTTGATGACTCTCAGGACAAAGCAGTGCTCAAGGGAGGACCCCTGGATGGCACTTACAGATTGATTCAGTTTCACTTTCACTGGGGTTCACTTGATGGACAAGGTTCAGAGCATACTGTGGATAAAAAGAAATATGCTGCAGAACTTCACTTGGTTCACTGGAACACCAAATATGGGGATTTTGGGAAAGCTGTGCAGCAACCTGATGGACTGGCCGTTCTAGGTATTTTTTTGAAGGTTGGCAGCGCTAAACCGGGCCTTCAGAAAGTTGTTGATGTGCTGGATTCCATTAAAACAAAGGGCAAGAGTGCTGACTTCACTAACTTCGATCCTCGTGGCCTCCTTCCTGAATCCTTGGATTACTGGACCTACCCAGGCTCACTGACCACCCCTCCTCTTCTGGAATGTGTGACCTGGATTGTGCTCAAGGAACCCATCAGCGTCAGCAGCGAGCAGGTGTTGAAATTCCGTAAACTTAACTTCAATGGGGAGGGTGAACCCGAAGAACTGATGGTGGACAACTGGCGCCCAGCTCAGCCACTGAAGAACAGGCAAATCAAAGCTTCCTTCAAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20401-Ab Anti-CA-II monoclonal antibody
    Target Antigen GM-Tg-g-T20401-Ag CA-II/CA2 protein
    ORF Viral Vector pGMLP002928 Human CA2 Lentivirus plasmid
    ORF Viral Vector vGMLP002928 Human CA2 Lentivirus particle


    Target information

    Target ID GM-T20401
    Target Name CA-II
    Gene ID 760, 12349, 574263, 54231, 101094903, 477928, 100050059
    Gene Symbol and Synonyms CA-II,CA2,CAC,CAII,Car-2,Car2,HEL-76,HEL-S-282,Ltw-5,Lvtw-5
    Uniprot Accession P00918
    Uniprot Entry Name CAH2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000104267
    Target Classification Not Available

    The protein encoded by this gene is one of several isozymes of carbonic anhydrase, which catalyzes reversible hydration of carbon dioxide. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.