Human DEFB103B/BD-3/DEFB-3 ORF/cDNA clone-Lentivirus particle (NM_018661)

Cat. No.: vGMLP003113

Pre-made Human DEFB103B/BD-3/DEFB-3 Lentiviral expression plasmid for DEFB103B lentivirus packaging, DEFB103B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to DEFB103A/DEFB103B/BD-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003113 Human DEFB103B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003113
Gene Name DEFB103B
Accession Number NM_018661
Gene ID 55894
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 204 bp
Gene Alias BD-3,DEFB-3,DEFB103,DEFB3,HBD-3,HBD3,HBP-3,HBP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGATCCATTATCTTCTGTTTGCTTTGCTCTTCCTGTTTTTGGTGCCTGTTCCAGGTCATGGAGGAATCATAAACACATTACAGAAATATTATTGCAGAGTCAGAGGCGGCCGGTGTGCTGTGCTCAGCTGCCTTCCAAAGGAGGAACAGATCGGCAAGTGCTCGACGCGTGGCCGAAAATGCTGCCGAAGAAAGAAATAA
ORF Protein Sequence MRIHYLLFALLFLFLVPVPGHGGIINTLQKYYCRVRGGRCAVLSCLPKEEQIGKCSTRGRKCCRRKK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0145-Ab Anti-D103A/ DEFB103A/ BD-3 functional antibody
    Target Antigen GM-Tg-g-SE0145-Ag DEFB103A protein
    ORF Viral Vector pGMLP003113 Human DEFB103B Lentivirus plasmid
    ORF Viral Vector vGMLP003113 Human DEFB103B Lentivirus particle


    Target information

    Target ID GM-SE0145
    Target Name DEFB103A
    Gene ID 414325
    Gene Symbol and Synonyms BD-3,DEFB-3,DEFB103,DEFB103A,DEFB3,HBD3,HBP-3,HBP3
    Uniprot Accession P81534
    Uniprot Entry Name D103A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000176797
    Target Classification Not Available

    Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 103, an antibiotic peptide which is induced by bacteria and interferon gamma, and which displays antimicrobial activity against S. aureus, S. pyogenes, P. aeruginosa, E. coli, and C. albicans. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.