Human FAAP20/C1orf86/FP7162 ORF/cDNA clone-Lentivirus particle (NM_182533)

Cat. No.: vGMLP003249

Pre-made Human FAAP20/C1orf86/FP7162 Lentiviral expression plasmid for FAAP20 lentivirus packaging, FAAP20 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to FAAP20/C1orf86 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003249 Human FAAP20 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003249
Gene Name FAAP20
Accession Number NM_182533
Gene ID 199990
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 543 bp
Gene Alias C1orf86,FP7162
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCGGCGCGGAGGCCGCGGCTGGGGTTGAGCCGCCGGAGGCCGCGCCCGGCGGGCGGGCCTTCTGGCGGCCGCCCCTGGTTTCTCCTGGGGGGTGATGAGCGGGAGCGGCTCTGGGCCGAGCTACTGCGCACGGTGAGCCCGGAGCTGATCCTGGATCACGAGGTGCCTTCACTGCCCGCCTTCCCAGGACAGGAGCCCAGGTGCGGCCCGGAGCCCACTGAAGTCTTCACTGTCGGACCCAAGACCTTTTCCTGGACACCCTTTCCGCCGGACCTGTGGGGCCCGGGCCGTTCCTACCGGCTGCTTCACGGGGCAGGAGGGCACCTGGAATCCCCCGCCAGGTCCCTGCCCCAGCGCCCGGCACCTGATCCCTGCAGGGCCCCCAGGGTGGAGCAGCAGCCGTCTGTGGAGGGTGCCGCGGCCCTGCGCAGCTGCCCCATGTGCCAGAAGGAGTTCGCCCCCAGGCTGACCCAGCTGGATGTTGACAGCCACCTGGCCCAGTGCTTGGCCGAAAGCACAGAAGACGTGACGTGGTGA
ORF Protein Sequence MEAARRPRLGLSRRRPRPAGGPSGGRPWFLLGGDERERLWAELLRTVSPELILDHEVPSLPAFPGQEPRCGPEPTEVFTVGPKTFSWTPFPPDLWGPGRSYRLLHGAGGHLESPARSLPQRPAPDPCRAPRVEQQPSVEGAAALRSCPMCQKEFAPRLTQLDVDSHLAQCLAESTEDVTW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2482-Ab Anti-FAAP20 monoclonal antibody
    Target Antigen GM-Tg-g-IP2482-Ag FAAP20 protein
    ORF Viral Vector pGMLP003249 Human FAAP20 Lentivirus plasmid
    ORF Viral Vector vGMLP003249 Human FAAP20 Lentivirus particle


    Target information

    Target ID GM-IP2482
    Target Name FAAP20
    Gene ID 199990, 67513, 697506, 362678, 102153783, 508039, 100064187
    Gene Symbol and Synonyms 2610002J02Rik,C16H1orf86,C1orf86,FAAP20,FP7162,RGD1308923
    Uniprot Accession Q6NZ36
    Uniprot Entry Name FAP20_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000162585
    Target Classification Not Available

    Enables K63-linked polyubiquitin modification-dependent protein binding activity and ubiquitin-dependent protein binding activity. Involved in interstrand cross-link repair and translesion synthesis. Located in cell junction; chromosome; and nuclear body. Part of Fanconi anaemia nuclear complex. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.