Human OGG1/HMMH/HOGG1 ORF/cDNA clone-Lentivirus particle (NM_016819)

Cat. No.: vGMLP003295

Pre-made Human OGG1/HMMH/HOGG1 Lentiviral expression plasmid for OGG1 lentivirus packaging, OGG1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to OGG1/HMMH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003295 Human OGG1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003295
Gene Name OGG1
Accession Number NM_016819
Gene ID 4968
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 975 bp
Gene Alias HMMH,HOGG1,MUTM,OGH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCTTCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCGGATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGAGACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTCCAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTCCAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGCCTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAGCGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGCTTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGCCTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGCGGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTCTGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGACAAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGCTGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGAAACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGAGTGTACCTAGGTGTCCTCCCTAG
ORF Protein Sequence MPARALLPRRMGHRTLASTPALWASIPCPRSELRLDLVLPSGQSFRWREQSPAHWSGVLADQVWTLTQTEEQLHCTVYRGDKSQASRPTPDELEAVRKYFQLDVTLAQLYHHWGSVDSHFQEVAQKFQGVRLLRQDPIECLFSFICSSNNNIARITGMVERLCQAFGPRLIQLDDVTYHGFPSLQALAGPEVEAHLRKLGLGYRARYVSASARAILEEQGGLAWLQQLRESSYEEAHKALCILPGVGTKVADCICLMALDKPQAVPVDVHMWHIAQRDYSWHPTTSQAKGPSPQTNKELGNFFRSLWGPYAGWAQAVSVPRCPP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92189-Ab Anti-OGG1 monoclonal antibody
    Target Antigen GM-Tg-g-T92189-Ag OGG1 protein
    ORF Viral Vector pGMLP003295 Human OGG1 Lentivirus plasmid
    ORF Viral Vector vGMLP003295 Human OGG1 Lentivirus particle


    Target information

    Target ID GM-T92189
    Target Name OGG1
    Gene ID 4968, 18294, 700481, 81528, 101091094, 484666, 520497, 100058398
    Gene Symbol and Synonyms HMMH,HOGG1,Mmh,MUTM,OGG1,OGH1
    Uniprot Accession O15527
    Uniprot Entry Name OGG1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000114026
    Target Classification Not Available

    This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.