Human ZPBP2/ZPBPL ORF/cDNA clone-Lentivirus particle (NM_198844)

Pre-made Human ZPBP2/ZPBPL Lentiviral expression plasmid for ZPBP2 lentivirus packaging, ZPBP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ZPBP2/ZPBPL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003346 Human ZPBP2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003346
Gene Name ZPBP2
Accession Number NM_198844
Gene ID 124626
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 951 bp
Gene Alias ZPBPL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGCGAACGTGCGTCCTACTCTCCGCGGTGCTCTGGTGCCTCACAGGAGACAAAATATATGTAGAGTTACATCAAAATAGTCCAGTCCTTATCTGTATGGATTTTAAGCTTTCTAAAAAAGAAATAGTGGACCCCACCTACTTATGGATTGGGCCTAATGAAAAGACGTTAACAGGAAATAATAGAATAAATATAACTGAAACTGGACAGCTGATGGTGAAAGATTTTTTGGAGCCTTTGTCTGGACTTTACACATGTACTCTTTCTTATAAGACTGTTAAAGCAGAAACTCAAGAAGAAAAAACAGTCAAAAAGAGATATGACTTTATGGTCTTTGCCTATCGGGAACCTGATTATTCATATCAGATGGCTGTACGTTTTACCACAAGGTCTTGTATAGGGAGATACAATGATGTATTCTTTAGAGTGCTGAAGAAAATCTTGGATAGTCTAATTTCTGATTTGTCATGCCATGTCATAGAGCCATCATATAAATGCCATTCTGTTGAAATTCCAGAACATGGCCTCATACATGAGCTATTTATAGCATTTCAAGTTAATCCTTTTGCGCCGGGGTGGAAAGGTGCTTGCAATGGATCTGTTGACTGTGAAGATACCACTAATCATAATATCCTCCAGGCAAGAGATCGAATAGAAGACTTTTTTCGGAGCCAAGCATATATTTTCTACCATAACTTTAATAAAACTCTACCAGCAATGCATTTTGTGGACCACAGTTTGCAAGTAGTACGTCTGGATAGCTGTCGACCAGGCTTTGGAAAAAATGAACGTCTACACAGTAATTGCGCTAGCTGTTGTGTGGTTTGTAGTCCTGCGACTTTTAGTCCTGATGTTAATGTAACTTGTCAGACCTGCGTTTCCGTCCTTACCTATGGAGCTAAATCTTGCCCACAAACTTCAAACAAAAATCAGCAATATGAAGATTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1389-Ab Anti-ZPBP2/ ZPBPL functional antibody
    Target Antigen GM-Tg-g-SE1389-Ag ZPBP2 protein
    ORF Viral Vector pGMLP003346 Human ZPBP2 Lentivirus plasmid
    ORF Viral Vector vGMLP003346 Human ZPBP2 Lentivirus particle


    Target information

    Target ID GM-SE1389
    Target Name ZPBP2
    Gene ID 124626, 69376, 698217, 363676, 101101601, 480531, 514334, 100068017
    Gene Symbol and Synonyms 1700017D11Rik,2610022C02Rik,ZPBP2,ZPBPL
    Uniprot Accession Q6X784
    Uniprot Entry Name ZPBP2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000186075
    Target Classification Not Available

    Predicted to be involved in acrosome assembly and binding activity of sperm to zona pellucida. Predicted to act upstream of or within membrane lipid metabolic process and regulation of gene expression. Located in nucleus. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.