Human CRYGD/CACA/CCA3 ORF/cDNA clone-Lentivirus particle (NM_006891)

Cat. No.: vGMLP003419

Pre-made Human CRYGD/CACA/CCA3 Lentiviral expression plasmid for CRYGD lentivirus packaging, CRYGD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CRYGD/CACA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003419 Human CRYGD Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003419
Gene Name CRYGD
Accession Number NM_006891
Gene ID 1421
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 525 bp
Gene Alias CACA,CCA3,CCP,cry-g-D,CRYG4,CTRCT4,PCC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAAGATCACCCTCTACGAGGACCGGGGCTTCCAGGGCCGCCACTATGAATGCAGCAGCGACCACCCCAACCTGCAGCCCTACTTGAGCCGCTGCAACTCGGCGCGCGTGGACAGCGGCTGCTGGATGCTCTATGAGCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCGCGGCGACTATGCCGACCACCAGCAGTGGATGGGCCTCAGCGACTCGGTCCGCTCCTGCCGCCTCATCCCCCACTCTGGCTCTCACAGGATCAGACTCTATGAGAGAGAGGACTACAGAGGCCAGATGATAGAGTTCACTGAGGACTGCTCCTGTCTTCAGGACCGCTTCCGCTTCAATGAAATCCACTCCCTCAACGTGCTGGAGGGCTCCTGGGTCCTCTACGAGCTGTCCAACTACCGAGGACGGCAGTACCTGCTGATGCCAGGGGACTATAGGCGCTACCAGGACTGGGGGGCCACGAATGCCAGAGTGGGCTCTCTGAGGAGAGTCATAGATTTCTCCTGA
ORF Protein Sequence MGKITLYEDRGFQGRHYECSSDHPNLQPYLSRCNSARVDSGCWMLYEQPNYSGLQYFLRRGDYADHQQWMGLSDSVRSCRLIPHSGSHRIRLYEREDYRGQMIEFTEDCSCLQDRFRFNEIHSLNVLEGSWVLYELSNYRGRQYLLMPGDYRRYQDWGATNARVGSLRRVIDFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2439-Ab Anti-CRYGD monoclonal antibody
    Target Antigen GM-Tg-g-IP2439-Ag CRYGD protein
    ORF Viral Vector pGMLP003419 Human CRYGD Lentivirus plasmid
    ORF Viral Vector vGMLP003419 Human CRYGD Lentivirus particle


    Target information

    Target ID GM-IP2439
    Target Name CRYGD
    Gene ID 1421
    Gene Symbol and Synonyms CACA,CCA3,CCP,cry-g-D,CRYG4,CRYGD,CTRCT4,PCC
    Uniprot Accession P07320
    Uniprot Entry Name CRGD_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000118231
    Target Classification Not Available

    Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.