Human CSN3/CNS10/CSN10 ORF/cDNA clone-Lentivirus particle (NM_005212)

Cat. No.: vGMLP003426

Pre-made Human CSN3/CNS10/CSN10 Lentiviral expression plasmid for CSN3 lentivirus packaging, CSN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CSN3/CNS10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003426 Human CSN3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003426
Gene Name CSN3
Accession Number NM_005212
Gene ID 1448
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 549 bp
Gene Alias CNS10,CSN10,CSNK,KCA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAGTTTTCTTCTAGTTGTCAATGCCCTGGCATTAACCCTGCCTTTTTTGGCTGTGGAGGTTCAAAACCAGAAACAACCAGCATGCCATGAGAATGATGAAAGACCATTCTATCAGAAAACAGCTCCATATGTCCCAATGTATTATGTGCCAAATAGCTATCCTTATTATGGAACCAATTTGTACCAACGTAGACCAGCTATAGCAATTAATAATCCATATGTGCCTCGCACATATTATGCAAACCCAGCTGTAGTTAGGCCACATGCCCAAATTCCTCAGCGGCAATACCTGCCAAATAGCCACCCACCCACTGTGGTACGTCGCCCAAACCTGCATCCATCATTTATTGCCATCCCCCCAAAGAAAATTCAGGATAAAATAATCATCCCTACCATCAATACCATTGCTACTGTTGAACCTACACCAGCTCCTGCCACTGAACCAACGGTGGACAGTGTAGTCACTCCAGAAGCTTTTTCAGAGTCCATCATCACGAGCACCCCTGAGACAACCACAGTTGCAGTTACTCCACCTACGGCATAA
ORF Protein Sequence MKSFLLVVNALALTLPFLAVEVQNQKQPACHENDERPFYQKTAPYVPMYYVPNSYPYYGTNLYQRRPAIAINNPYVPRTYYANPAVVRPHAQIPQRQYLPNSHPPTVVRRPNLHPSFIAIPPKKIQDKIIIPTINTIATVEPTPAPATEPTVDSVVTPEAFSESIITSTPETTTVAVTPPTA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0831-Ab Anti-CASK/ CSN3/ CNS10 functional antibody
    Target Antigen GM-Tg-g-SE0831-Ag CSN3 protein
    ORF Viral Vector pGMLP003426 Human CSN3 Lentivirus plasmid
    ORF Viral Vector vGMLP003426 Human CSN3 Lentivirus particle


    Target information

    Target ID GM-SE0831
    Target Name CSN3
    Gene ID 1448, 12994, 707297, 29188, 101086056, 100685434, 281728, 100033983
    Gene Symbol and Synonyms CNS10,CSN10,CSN3,CSN3K,CSNK,KCA
    Uniprot Accession P07498
    Uniprot Entry Name CASK_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000171209
    Target Classification Not Available

    Involved in lactation and protein stabilization. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.