Human C1orf198 ORF/cDNA clone-Lentivirus particle (NM_001136494)

Pre-made Human C1orf198/ Lentiviral expression plasmid for C1orf198 lentivirus packaging, C1orf198 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to C1orf198/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003513 Human C1orf198 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003513
Gene Name C1orf198
Accession Number NM_001136494
Gene ID 84886
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 870 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCAGGAAGATCATGCAGGACAAGGAGAAGATCCGCGAGAAGTACGGGCCCGAGTGGGCGCGGCTGCCGCCCGCGCAGCAGGACGAGATCATCGACCGGTGCCTGGTGGGGCCGCGCGCCCCGGCGCCCCGAGACCCCGGGGACTCGGAGGAGCTCACGCGCTTCCCCGGCTTGCGCGGGCCCACGGGCCAGAAGGTGGTGCGCTTCGGGGACGAGGATCTAACTTGGCAAGATGAGCACTCTGCCCCTTTCTCCTGGGAAACAAAGAGTCAGATGGAGTTCAGTATCTCCGCCCTATCCATCCAGGAGCCGAGCAACGGCACCGCCGCCAGCGAGCCCAGACCACTGTCCAAAGCTTCCCAGGGCTCCCAGGCCCTCAAGTCCTCCCAAGGCAGCAGGTCCTCCAGCCTGGACGCCCTGGGCCCCACCAGGAAGGAGGAGGAAGCGTCATTCTGGAAGATCAATGCTGAGCGGTCCCGAGGGGAGGGGCCTGAGGCCGAGTTCCAGTCGCTGACCCCTAGCCAGATCAAGTCCATGGAGAAGGGGGAAAAGGTCTTGCCTCCCTGCTACCGGCAGGAACCTGCCCCGAAGGACAGGGAGGCCAAGGTGGAAAGGCCCAGCACCCTCCGTCAGGAGCAGCGTCCTCTTCCCAACGTGAGCACCGAACGTGAGAGACCCCAGCCTGTCCAGGCCTTCAGCAGTGCACTGCACGAGGCTGCCCCCTCCCAGCTCGAGGGGAAGCTGCCATCTCCTGATGTCAGGCAGGACGATGGGGAAGACACCCTGTTCTCGGAACCCAAGTTTGCACAGGTCAGCTCAAGTAATGTCGTCTTGAAGACGGGATTTGATTTTCTGGACAATTGGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1476-Ab Anti-CA198/ C1orf198 functional antibody
    Target Antigen GM-Tg-g-SE1476-Ag C1orf198 protein
    ORF Viral Vector pGMLP003513 Human C1orf198 Lentivirus plasmid
    ORF Viral Vector vGMLP003513 Human C1orf198 Lentivirus particle


    Target information

    Target ID GM-SE1476
    Target Name C1orf198
    Gene ID 84886, 69551, 714084, 498967, 101093463, 608029, 616380, 100061368
    Gene Symbol and Synonyms 2310022B05Rik,C19h1orf198,C1H1orf198,C1orf198,C28H1orf198,C4H1orf198,CD2H1orf198,RGD1559896
    Uniprot Accession Q9H425
    Uniprot Entry Name CA198_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000119280
    Target Classification Not Available

    Located in cytosol. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.