Human FUT7/FucT-VII ORF/cDNA clone-Lentivirus particle (NM_004479)

Cat. No.: vGMLP003556

Pre-made Human FUT7/FucT-VII Lentiviral expression plasmid for FUT7 lentivirus packaging, FUT7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to FUT7/FucT-VII products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003556 Human FUT7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003556
Gene Name FUT7
Accession Number NM_004479
Gene ID 2529
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1029 bp
Gene Alias FucT-VII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATAATGCTGGGCACGGCCCCACCCGGAGGCTGCGAGGCTTGGGGGTCCTGGCCGGGGTGGCTCTGCTCGCTGCCCTCTGGCTCCTGTGGCTGCTGGGGTCAGCCCCTCGGGGTACCCCGGCACCCCAGCCCACGATCACCATCCTTGTCTGGCACTGGCCCTTCACTGACCAGCCCCCAGAGCTGCCCAGCGACACCTGCACCCGCTACGGCATCGCCCGCTGCCACCTGAGTGCCAACCGAAGCCTGCTGGCCAGCGCCGACGCCGTGGTCTTCCACCACCGCGAGCTGCAGACCCGGCGGTCCCACCTGCCCCTGGCCCAGCGGCCGCGAGGGCAGCCCTGGGTGTGGGCCTCCATGGAGTCTCCTAGCCACACCCACGGCCTCAGCCACCTCCGAGGCATCTTCAACTGGGTGCTGAGCTACCGGCGCGACTCGGACATCTTTGTGCCCTATGGCCGCCTGGAGCCCCACTGGGGGCCCTCGCCACCGCTGCCAGCCAAGAGCAGGGTGGCCGCCTGGGTGGTCAGCAACTTCCAGGAGCGGCAGCTGCGTGCCAGGCTGTACCGGCAGCTGGCGCCTCATCTGCGGGTGGATGTCTTTGGCCGTGCCAATGGACGGCCACTGTGCGCCAGCTGCCTGGTGCCCACCGTGGCCCAGTACCGCTTCTACCTGTCCTTTGAGAACTCTCAGCACCGCGACTACATTACGGAGAAATTCTGGCGCAACGCACTGGTGGCTGGCACTGTGCCAGTGGTGCTGGGGCCCCCACGGGCCACCTATGAGGCCTTCGTGCCGGCTGACGCCTTCGTGCATGTGGATGACTTTGGCTCAGCCCGAGAGCTGGCGGCTTTCCTCACTGGCATGAATGAGAGCCGATACCAACGCTTCTTTGCCTGGCGTGACAGGCTCCGCGTGCGACTGTTCACCGACTGGCGGGAACGTTTCTGTGCCATCTGTGACCGCTACCCACACCTACCCCGCAGCCAAGTCTATGAGGACCTTGAGGGTTGGTTTCAGGCCTGA
ORF Protein Sequence MNNAGHGPTRRLRGLGVLAGVALLAALWLLWLLGSAPRGTPAPQPTITILVWHWPFTDQPPELPSDTCTRYGIARCHLSANRSLLASADAVVFHHRELQTRRSHLPLAQRPRGQPWVWASMESPSHTHGLSHLRGIFNWVLSYRRDSDIFVPYGRLEPHWGPSPPLPAKSRVAAWVVSNFQERQLRARLYRQLAPHLRVDVFGRANGRPLCASCLVPTVAQYRFYLSFENSQHRDYITEKFWRNALVAGTVPVVLGPPRATYEAFVPADAFVHVDDFGSARELAAFLTGMNESRYQRFFAWRDRLRVRLFTDWRERFCAICDRYPHLPRSQVYEDLEGWFQA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0870-Ab Anti-FUT7 monoclonal antibody
    Target Antigen GM-Tg-g-IP0870-Ag FUT7 protein
    ORF Viral Vector pGMLP003556 Human FUT7 Lentivirus plasmid
    ORF Viral Vector vGMLP003556 Human FUT7 Lentivirus particle


    Target information

    Target ID GM-IP0870
    Target Name FUT7
    Gene ID 2529, 14347, 720913, 296564, 105261143, 449026, 100036592, 100067846
    Gene Symbol and Synonyms FTVII,Fuc-TVII,FucT-VII,FUT7
    Uniprot Accession Q11130
    Uniprot Entry Name FUT7_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000180549
    Target Classification Not Available

    The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X antigens. The encoded protein can direct the synthesis of the E-selectin-binding sialyl-Lewis X moiety. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.