Human NAAA/ASAHL/PLT ORF/cDNA clone-Lentivirus particle (NM_014435)

Cat. No.: vGMLP003588

Pre-made Human NAAA/ASAHL/PLT Lentiviral expression plasmid for NAAA lentivirus packaging, NAAA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NAAA/ASAHL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003588 Human NAAA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003588
Gene Name NAAA
Accession Number NM_014435
Gene ID 27163
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1080 bp
Gene Alias ASAHL,PLT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGACCGCGGACCGGGAGGCGCGCCCGGGGCTTCCGTCCCTGCTGCTGCTGCTGCTGGCCGGGGCCGGGCTGTCAGCCGCCTCGCCCCCAGCAGCGCCGCGCTTCAACGTGAGCCTGGACTCGGTCCCCGAGCTGCGCTGGCTGCCCGTGCTGCGGCACTACGACTTGGACTTGGTGCGCGCCGCGATGGCGCAAGTCATCGGGGACAGAGTCCCCAAGTGGGTGCACGTGTTAATCGGAAAAGTGGTCCTGGAGCTGGAGCGCTTCCTGCCCCAGCCCTTCACCGGCGAGATCCGCGGCATGTGTGACTTCATGAACCTCAGCCTGGCGGACTGCCTTCTGGTCAACCTGGCCTACGAGTCCTCCGTGTTCTGCACCAGTATTGTGGCTCAAGACTCCAGAGGCCACATTTACCATGGTCGGAATTTGGATTATCCTTTTGGGAATGTCTTACGCAAGCTGACAGTGGATGTGCAATTCTTAAAGAATGGGCAGATTGCATTCACAGGAACTACTTTTATTGGCTATGTAGGATTATGGACTGGCCAGAGCCCACACAAGTTTACAGTTTCTGGTGATGAACGAGATAAAGGCTGGTGGTGGGAGAATGCTATCGCTGCCCTGTTTCGGAGACACATTCCCGTCAGCTGGCTGATCCGCGCTACCCTGAGTGAGTCGGAAAACTTCGAAGCAGCTGTTGGCAAGTTGGCCAAGACTCCCCTTATTGCTGATGTTTATTACATTGTTGGTGGCACGTCCCCCCGGGAGGGGGTGGTCATCACGAGGAACAGAGATGGCCCAGCAGACATTTGGCCTCTAGATCCTTTGAATGGAGCGTGGTTCCGAGTTGAGACAAATTACGACCACTGGAAGCCAGCACCCAAGGAAGATGACCGGAGAACATCTGCCATCAAGGCCCTTAATGCTACAGGACAAGCAAACCTCAGCCTGGAGGCACTTTTCCAGATTTTGTCGGTGGTTCCAGTTTATAACAACTTCACAATTTATACTACGGTAATGAGCGCCGGTAGCCCAGACAAGTACATGACTAGGATCAGAAACCCGAGTAGAAAGTAA
ORF Protein Sequence MRTADREARPGLPSLLLLLLAGAGLSAASPPAAPRFNVSLDSVPELRWLPVLRHYDLDLVRAAMAQVIGDRVPKWVHVLIGKVVLELERFLPQPFTGEIRGMCDFMNLSLADCLLVNLAYESSVFCTSIVAQDSRGHIYHGRNLDYPFGNVLRKLTVDVQFLKNGQIAFTGTTFIGYVGLWTGQSPHKFTVSGDERDKGWWWENAIAALFRRHIPVSWLIRATLSESENFEAAVGKLAKTPLIADVYYIVGGTSPREGVVITRNRDGPADIWPLDPLNGAWFRVETNYDHWKPAPKEDDRRTSAIKALNATGQANLSLEALFQILSVVPVYNNFTIYTTVMSAGSPDKYMTRIRNPSRK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78326-Ab Anti-NAAA/ ASAHL/ PLT functional antibody
    Target Antigen GM-Tg-g-T78326-Ag NAAA protein
    ORF Viral Vector pGMLP003588 Human NAAA Lentivirus plasmid
    ORF Viral Vector vGMLP003588 Human NAAA Lentivirus particle


    Target information

    Target ID GM-T78326
    Target Name NAAA
    Gene ID 27163, 67111, 700991, 497009, 101091867, 515375, 100057831
    Gene Symbol and Synonyms 2210023K21Rik,3830414F09Rik,ASAHL,NAAA,PLT
    Uniprot Accession Q02083
    Uniprot Entry Name NAAA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000138744
    Target Classification Not Available

    This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.