Human ST6GAL1/SIAT1/ ST6GalI ORF/cDNA clone-Lentivirus particle (NM_173216)

Pre-made Human ST6GAL1/SIAT1/ ST6GalI Lentiviral expression plasmid for ST6GAL1 lentivirus packaging, ST6GAL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ST6GAL1/SIAT1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003653 Human ST6GAL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003653
Gene Name ST6GAL1
Accession Number NM_173216
Gene ID 6480
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1221 bp
Gene Alias SIAT1, ST6GalI, ST6N
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATTCACACCAACCTGAAGAAAAAGTTCAGCTGCTGCGTCCTGGTCTTTCTTCTGTTTGCAGTCATCTGTGTGTGGAAGGAAAAGAAGAAAGGGAGTTACTATGATTCCTTTAAATTGCAAACCAAGGAATTCCAGGTGTTAAAGAGTCTGGGGAAATTGGCCATGGGGTCTGATTCCCAGTCTGTATCCTCAAGCAGCACCCAGGACCCCCACAGGGGCCGCCAGACCCTCGGCAGTCTCAGAGGCCTAGCCAAGGCCAAACCAGAGGCCTCCTTCCAGGTGTGGAACAAGGACAGCTCTTCCAAAAACCTTATCCCTAGGCTGCAAAAGATCTGGAAGAATTACCTAAGCATGAACAAGTACAAAGTGTCCTACAAGGGGCCAGGACCAGGCATCAAGTTCAGTGCAGAGGCCCTGCGCTGCCACCTCCGGGACCATGTGAATGTATCCATGGTAGAGGTCACAGATTTTCCCTTCAATACCTCTGAATGGGAGGGTTATCTGCCCAAGGAGAGCATTAGGACCAAGGCTGGGCCTTGGGGCAGGTGTGCTGTTGTGTCGTCAGCGGGATCTCTGAAGTCCTCCCAACTAGGCAGAGAAATCGATGATCATGACGCAGTCCTGAGGTTTAATGGGGCACCCACAGCCAACTTCCAACAAGATGTGGGCACAAAAACTACCATTCGCCTGATGAACTCTCAGTTGGTTACCACAGAGAAGCGCTTCCTCAAAGACAGTTTGTACAATGAAGGAATCCTAATTGTATGGGACCCATCTGTATACCACTCAGATATCCCAAAGTGGTACCAGAATCCGGATTATAATTTCTTTAACAACTACAAGACTTATCGTAAGCTGCACCCCAATCAGCCCTTTTACATCCTCAAGCCCCAGATGCCTTGGGAGCTATGGGACATTCTTCAAGAAATCTCCCCAGAAGAGATTCAGCCAAACCCCCCATCCTCTGGGATGCTTGGTATCATCATCATGATGACGCTGTGTGACCAGGTGGATATTTATGAGTTCCTCCCATCCAAGCGCAAGACTGACGTGTGCTACTACTACCAGAAGTTCTTCGATAGTGCCTGCACGATGGGTGCCTACCACCCGCTGCTCTATGAGAAGAATTTGGTGAAGCATCTCAACCAGGGCACAGATGAGGACATCTACCTGCTTGGAAAAGCCACACTGCCTGGCTTCCGGACCATTCACTGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1325-Ab Anti-SIAT1/ ST6GAL1/ ST6GalI functional antibody
    Target Antigen GM-Tg-g-SE1325-Ag ST6GAL1 protein
    ORF Viral Vector pGMLP003653 Human ST6GAL1 Lentivirus plasmid
    ORF Viral Vector vGMLP003653 Human ST6GAL1 Lentivirus particle


    Target information

    Target ID GM-SE1325
    Target Name ST6GAL1
    Gene ID 6480, 20440, 708113, 25197, 101097832, 478668, 282073, 100059539
    Gene Symbol and Synonyms CDw75,SIAT1,St6gal,St6Gal-I,ST6GAL1,ST6GalI,ST6N
    Uniprot Accession P15907
    Uniprot Entry Name SIAT1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000073849
    Target Classification Not Available

    This gene encodes a member of glycosyltransferase family 29. The encoded protein is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The protein, which is normally found in the Golgi but can be proteolytically processed to a soluble form, is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CD75, and CD76. This gene has been incorrectly referred to as CD75. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.