Human NR0B2/SHP/SHP1 ORF/cDNA clone-Lentivirus particle (NM_021969)
Cat. No.: vGMLP003773
Pre-made Human NR0B2/SHP/SHP1 Lentiviral expression plasmid for NR0B2 lentivirus packaging, NR0B2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
NR0B2/SHP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003773 | Human NR0B2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003773 |
Gene Name | NR0B2 |
Accession Number | NM_021969 |
Gene ID | 8431 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 774 bp |
Gene Alias | SHP,SHP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCACCAGCCAACCAGGGGCCTGCCCATGCCAGGGAGCTGCAAGCCGCCCCGCCATTCTCTACGCACTTCTGAGCTCCAGCCTCAAGGCTGTCCCCCGACCCCGTAGCCGCTGCCTATGTAGGCAGCACCGGCCCGTCCAGCTATGTGCACCTCATCGCACCTGCCGGGAGGCCTTGGATGTTCTGGCCAAGACAGTGGCCTTCCTCAGGAACCTGCCATCCTTCTGGCAGCTGCCTCCCCAGGACCAGCGGCGGCTGCTGCAGGGTTGCTGGGGCCCCCTCTTCCTGCTTGGGTTGGCCCAAGATGCTGTGACCTTTGAGGTGGCTGAGGCCCCGGTGCCCAGCATACTCAAGAAGATTCTGCTGGAGGAGCCCAGCAGCAGTGGAGGCAGTGGCCAACTGCCAGACAGACCCCAGCCCTCCCTGGCTGCGGTGCAGTGGCTTCAATGCTGTCTGGAGTCCTTCTGGAGCCTGGAGCTTAGCCCCAAGGAATATGCCTGCCTGAAAGGGACCATCCTCTTCAACCCCGATGTGCCAGGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGTGAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACGGCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATCATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTGA |
ORF Protein Sequence | MSTSQPGACPCQGAASRPAILYALLSSSLKAVPRPRSRCLCRQHRPVQLCAPHRTCREALDVLAKTVAFLRNLPSFWQLPPQDQRRLLQGCWGPLFLLGLAQDAVTFEVAEAPVPSILKKILLEEPSSSGGSGQLPDRPQPSLAAVQWLQCCLESFWSLELSPKEYACLKGTILFNPDVPGLQAASHIGHLQQEAHWVLCEVLEPWCPAAQGRLTRVLLTASTLKSIPTSLLGDLFFRPIIGDVDIAGLLGDMLLLR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89859-Ab | Anti-NR0B2 monoclonal antibody |
Target Antigen | GM-Tg-g-T89859-Ag | NR0B2 protein |
ORF Viral Vector | pGMLP003773 | Human NR0B2 Lentivirus plasmid |
ORF Viral Vector | vGMLP003773 | Human NR0B2 Lentivirus particle |
Target information
Target ID | GM-T89859 |
Target Name | NR0B2 |
Gene ID | 8431, 23957, 715170, 117274, 101081062, 612125, 514770, 100070986 |
Gene Symbol and Synonyms | NR0B2,SHP,SHP-1,SHP1 |
Uniprot Accession | Q15466 |
Uniprot Entry Name | NR0B2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000131910 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is an unusual orphan receptor that contains a putative ligand-binding domain but lacks a conventional DNA-binding domain. The gene product is a member of the nuclear hormone receptor family, a group of transcription factors regulated by small hydrophobic hormones, a subset of which do not have known ligands and are referred to as orphan nuclear receptors. The protein has been shown to interact with retinoid and thyroid hormone receptors, inhibiting their ligand-dependent transcriptional activation. In addition, interaction with estrogen receptors has been demonstrated, leading to inhibition of function. Studies suggest that the protein represses nuclear hormone receptor-mediated transactivation via two separate steps: competition with coactivators and the direct effects of its transcriptional repressor function. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.