Human NR0B2/SHP/SHP1 ORF/cDNA clone-Lentivirus particle (NM_021969)

Cat. No.: vGMLP003773

Pre-made Human NR0B2/SHP/SHP1 Lentiviral expression plasmid for NR0B2 lentivirus packaging, NR0B2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NR0B2/SHP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003773 Human NR0B2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003773
Gene Name NR0B2
Accession Number NM_021969
Gene ID 8431
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 774 bp
Gene Alias SHP,SHP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCACCAGCCAACCAGGGGCCTGCCCATGCCAGGGAGCTGCAAGCCGCCCCGCCATTCTCTACGCACTTCTGAGCTCCAGCCTCAAGGCTGTCCCCCGACCCCGTAGCCGCTGCCTATGTAGGCAGCACCGGCCCGTCCAGCTATGTGCACCTCATCGCACCTGCCGGGAGGCCTTGGATGTTCTGGCCAAGACAGTGGCCTTCCTCAGGAACCTGCCATCCTTCTGGCAGCTGCCTCCCCAGGACCAGCGGCGGCTGCTGCAGGGTTGCTGGGGCCCCCTCTTCCTGCTTGGGTTGGCCCAAGATGCTGTGACCTTTGAGGTGGCTGAGGCCCCGGTGCCCAGCATACTCAAGAAGATTCTGCTGGAGGAGCCCAGCAGCAGTGGAGGCAGTGGCCAACTGCCAGACAGACCCCAGCCCTCCCTGGCTGCGGTGCAGTGGCTTCAATGCTGTCTGGAGTCCTTCTGGAGCCTGGAGCTTAGCCCCAAGGAATATGCCTGCCTGAAAGGGACCATCCTCTTCAACCCCGATGTGCCAGGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGTGAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACGGCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATCATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTGA
ORF Protein Sequence MSTSQPGACPCQGAASRPAILYALLSSSLKAVPRPRSRCLCRQHRPVQLCAPHRTCREALDVLAKTVAFLRNLPSFWQLPPQDQRRLLQGCWGPLFLLGLAQDAVTFEVAEAPVPSILKKILLEEPSSSGGSGQLPDRPQPSLAAVQWLQCCLESFWSLELSPKEYACLKGTILFNPDVPGLQAASHIGHLQQEAHWVLCEVLEPWCPAAQGRLTRVLLTASTLKSIPTSLLGDLFFRPIIGDVDIAGLLGDMLLLR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89859-Ab Anti-NR0B2 monoclonal antibody
    Target Antigen GM-Tg-g-T89859-Ag NR0B2 protein
    ORF Viral Vector pGMLP003773 Human NR0B2 Lentivirus plasmid
    ORF Viral Vector vGMLP003773 Human NR0B2 Lentivirus particle


    Target information

    Target ID GM-T89859
    Target Name NR0B2
    Gene ID 8431, 23957, 715170, 117274, 101081062, 612125, 514770, 100070986
    Gene Symbol and Synonyms NR0B2,SHP,SHP-1,SHP1
    Uniprot Accession Q15466
    Uniprot Entry Name NR0B2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000131910
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is an unusual orphan receptor that contains a putative ligand-binding domain but lacks a conventional DNA-binding domain. The gene product is a member of the nuclear hormone receptor family, a group of transcription factors regulated by small hydrophobic hormones, a subset of which do not have known ligands and are referred to as orphan nuclear receptors. The protein has been shown to interact with retinoid and thyroid hormone receptors, inhibiting their ligand-dependent transcriptional activation. In addition, interaction with estrogen receptors has been demonstrated, leading to inhibition of function. Studies suggest that the protein represses nuclear hormone receptor-mediated transactivation via two separate steps: competition with coactivators and the direct effects of its transcriptional repressor function. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.