Human OLIG2/BHLHB1/bHLHe19 ORF/cDNA clone-Lentivirus particle (NM_005806)

Cat. No.: vGMLP003789

Pre-made Human OLIG2/BHLHB1/bHLHe19 Lentiviral expression plasmid for OLIG2 lentivirus packaging, OLIG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to OLIG2/BHLHB1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003789 Human OLIG2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003789
Gene Name OLIG2
Accession Number NM_005806
Gene ID 10215
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 972 bp
Gene Alias BHLHB1,bHLHe19,OLIGO2,PRKCBP2,RACK17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACTCGGACGCCAGCCTGGTGTCCAGCCGCCCGTCGTCGCCAGAGCCCGATGACCTTTTTCTGCCGGCCCGGAGTAAGGGCAGCAGCGGCAGCGCCTTCACTGGGGGCACCGTGTCCTCGTCCACCCCGAGTGACTGCCCGCCGGAGCTGAGCGCCGAGCTGCGCGGCGCTATGGGCTCTGCGGGCGCGCATCCTGGGGACAAGCTAGGAGGCAGTGGCTTCAAGTCATCCTCGTCCAGCACCTCGTCGTCTACGTCGTCGGCGGCTGCGTCGTCCACCAAGAAGGACAAGAAGCAAATGACAGAGCCGGAGCTGCAGCAGCTGCGTCTCAAGATCAACAGCCGCGAGCGCAAGCGCATGCACGACCTCAACATCGCCATGGATGGCCTCCGCGAGGTCATGCCGTACGCACACGGCCCTTCGGTGCGCAAGCTTTCCAAGATCGCCACGCTGCTGCTGGCGCGCAACTACATCCTCATGCTCACCAACTCGCTGGAGGAGATGAAGCGACTGGTGAGCGAGATCTACGGGGGCCACCACGCTGGCTTCCACCCGTCGGCCTGCGGCGGCCTGGCGCACTCCGCGCCCCTGCCCGCCGCCACCGCGCACCCGGCAGCAGCAGCGCACGCCGCACATCACCCCGCGGTGCACCACCCCATCCTGCCGCCCGCCGCCGCAGCGGCTGCTGCCGCCGCTGCAGCCGCGGCTGTGTCCAGCGCCTCTCTGCCCGGATCCGGGCTGCCGTCGGTCGGCTCCATCCGTCCACCGCACGGCCTACTCAAGTCTCCGTCTGCTGCCGCGGCCGCCCCGCTGGGGGGCGGGGGCGGCGGCAGTGGGGCGAGCGGGGGCTTCCAGCACTGGGGCGGCATGCCCTGCCCCTGCAGCATGTGCCAGGTGCCGCCGCCGCACCACCACGTGTCGGCTATGGGCGCCGGCAGCCTGCCGCGCCTCACCTCCGACGCCAAGTGA
ORF Protein Sequence MDSDASLVSSRPSSPEPDDLFLPARSKGSSGSAFTGGTVSSSTPSDCPPELSAELRGAMGSAGAHPGDKLGGSGFKSSSSSTSSSTSSAAASSTKKDKKQMTEPELQQLRLKINSRERKRMHDLNIAMDGLREVMPYAHGPSVRKLSKIATLLLARNYILMLTNSLEEMKRLVSEIYGGHHAGFHPSACGGLAHSAPLPAATAHPAAAAHAAHHPAVHHPILPPAAAAAAAAAAAAAVSSASLPGSGLPSVGSIRPPHGLLKSPSAAAAAPLGGGGGGSGASGGFQHWGGMPCPCSMCQVPPPHHHVSAMGAGSLPRLTSDAK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2635-Ab Anti-OLIG2 monoclonal antibody
    Target Antigen GM-Tg-g-IP2635-Ag OLIG2 protein
    ORF Viral Vector pGMLP003789 Human OLIG2 Lentivirus plasmid
    ORF Viral Vector vGMLP003789 Human OLIG2 Lentivirus particle


    Target information

    Target ID GM-IP2635
    Target Name OLIG2
    Gene ID 10215, 50913, 700098, 304103, 101093039, 100856424, 539695, 100146475
    Gene Symbol and Synonyms BHLHB1,bHLHe19,Olg-2,OLIG2,OLIGO2,PRKCBP2,RACK17,RK17
    Uniprot Accession Q13516
    Uniprot Entry Name OLIG2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease IgA glomerulonephritis
    Gene Ensembl ENSG00000205927
    Target Classification Not Available

    This gene encodes a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(q11.2;q22) associated with T-cell acute lymphoblastic leukemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.