Human TM4SF1/H-L6/L6 ORF/cDNA clone-Lentivirus particle (NM_014220)

Cat. No.: vGMLP003951

Pre-made Human TM4SF1/H-L6/L6 Lentiviral expression plasmid for TM4SF1 lentivirus packaging, TM4SF1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TM4SF1/H-L6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003951 Human TM4SF1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003951
Gene Name TM4SF1
Accession Number NM_014220
Gene ID 4071
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 609 bp
Gene Alias H-L6,L6,M3S1,TAAL6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGCTATGGGAAGTGTGCACGATGCATCGGACATTCTCTGGTGGGGCTCGCCCTCCTGTGCATCGCGGCTAATATTTTGCTTTACTTTCCCAATGGGGAAACAAAGTATGCCTCCGAAAACCACCTCAGCCGCTTCGTGTGGTTCTTTTCTGGCATCGTAGGAGGTGGCCTGCTGATGCTCCTGCCAGCATTTGTCTTCATTGGGCTGGAACAGGATGACTGCTGTGGCTGCTGTGGCCATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAA
ORF Protein Sequence MCYGKCARCIGHSLVGLALLCIAANILLYFPNGETKYASENHLSRFVWFFSGIVGGGLLMLLPAFVFIGLEQDDCCGCCGHENCGKRCAMLSSVLAALIGIAGSGYCVIVAALGLAEGPLCLDSLGQWNYTFASTEGQYLLDTSTWSECTEPKHIVEWNVSLFSILLALGGIEFILCLIQVINGVLGGICGFCCSHQQQYDC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1922-Ab Anti-TM4SF1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1922-Ag TM4SF1 protein
    ORF Viral Vector pGMLP003951 Human TM4SF1 Lentivirus plasmid
    ORF Viral Vector pGMLP004020 Human TM4SF1 Lentivirus plasmid
    ORF Viral Vector vGMLP003951 Human TM4SF1 Lentivirus particle
    ORF Viral Vector vGMLP004020 Human TM4SF1 Lentivirus particle


    Target information

    Target ID GM-IP1922
    Target Name TM4SF1
    Gene ID 4071, 17112, 711908, 295061, 101101157, 485710, 533038, 100050742
    Gene Symbol and Synonyms H-L6,L6,M3S1,TAAL6,TM4SF1
    Uniprot Accession P30408
    Uniprot Entry Name T4S1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000169908
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface antigen and is highly expressed in different carcinomas. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.