Human SPACA7/C13orf28 ORF/cDNA clone-Lentivirus particle (NM_145248)

Pre-made Human SPACA7/C13orf28 Lentiviral expression plasmid for SPACA7 lentivirus packaging, SPACA7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SPACA7/C13orf28 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003962 Human SPACA7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003962
Gene Name SPACA7
Accession Number NM_145248
Gene ID 122258
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 588 bp
Gene Alias C13orf28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGTGAGCCAAGGAGACGGGACCCTCTGCTTTGTCCTCCTGCTGTGCTGTTGGCAAGAAACTGAGCTCCGGCCGAGAACCGTGATTCCAGGTTCACCTACTGAAATACCATTCAGTTCAAAACAGGAGGATATGTCTGAATTATTAGATGAAATTCTGGTCCAGGAGATTTTAGATCTGAATAAAACAACACCGAGCGAAATGCCAAGTACAGCATCAACATTATCAACACCGTTACATGCTGGTATTGATGAGAATTATCAAGCTGGTGGTTCTGAGAATTACCATGAATTATTAGAGAATTTACAATTCTCTCCTGGCATTGAGGTCAAAATTTCCAATGATGAAGCCAATGCTAATGCAAATCTCCATGGCGATCCTTCTGAGAATTATCGTGGGCCACAGGTGTCTCCTGGCAGTGAGAAGAGTGTTTCCAGTAAAGAAAAGAATTCAAAGAACACTCAGTATGAAAATCTATCCATTCTGGACCAAATCCTTCAAAATATTGGAAGATCTTCAGGAAACATTTTCCATAAAGAGCAGCAGAGGACCAGCGCACAGAGGAGGAGCCAAGGCAGTCAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1304-Ab Anti-SPAC7/ SPACA7/ C13orf28 functional antibody
    Target Antigen GM-Tg-g-SE1304-Ag SPACA7 protein
    ORF Viral Vector pGMLV000025 Human SPACA7 Lentivirus plasmid
    ORF Viral Vector pGMLP003962 Human SPACA7 Lentivirus plasmid
    ORF Viral Vector vGMLV000025 Human SPACA7 Lentivirus particle
    ORF Viral Vector vGMLP003962 Human SPACA7 Lentivirus particle


    Target information

    Target ID GM-SE1304
    Target Name SPACA7
    Gene ID 122258, 78634, 695869, 689077, 102899981, 781940, 106781882
    Gene Symbol and Synonyms 1700094C09Rik,C13orf28,SPACA7
    Uniprot Accession Q96KW9
    Uniprot Entry Name SPAC7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000153498
    Target Classification Not Available

    Predicted to act upstream of or within negative regulation of cell adhesion and single fertilization. Located in acrosomal vesicle. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.