Human MAGEA4/MAGE-41/ MAGE-X2 ORF/cDNA clone-Lentivirus particle (BC017723)

Pre-made Human MAGEA4/MAGE-41/ MAGE-X2 Lentiviral expression plasmid for MAGEA4 lentivirus packaging, MAGEA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MAGEA4/MAGE-41 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004051 Human MAGEA4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004051
Gene Name MAGEA4
Accession Number BC017723
Gene ID 4103
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 954 bp
Gene Alias MAGE-41, MAGE-X2, MAGE4A, MAGE4B, MGC21336
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCTTCTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCGTTGAGGCCCAAGAAGAGGCCCTGGGCCTGGTGGGTGCACAGGCTCCTACTACTGAGGAGCAGGAGGCTGCTGTCTCCTCCTCCTCTCCTCTGGTCCCTGGCACCCTGGAGGAAGTGCCTGCTGCTGAGTCAGCAGGTCCTCCCCAGAGTCCTCAGGGAGCCTCTGCCTTACCCACTACCATCAGCTTCACTTGCTGGAGGCAACCCAATGAGGGTTCCAGCAGCCAAGAAGAGGAGGGGCCAAGCACCTCGCCTGACGCAGAGTCCTTGTTCCGAGAAGCACTCAGTAACAAGGTGGATGAGTTGGCTCATTTTCTGCTCCGCAAGTATCGAGCCAAGGAGCTGGTCACAAAGGCAGAAATGCTGGAGAGAGTCATCAAAAATTACAAGCGCTGCTTTCCTGTGATCTTCGGCAAAGCCTCCGAGTCCCTGAAGATGATCTTTGGCATTGACGTGAAGGAAGTGGACCCCACCAGCAACACCTACACCCTTGTCACCTGCCTGGGCCTTTCCTATGATGGCCTGCTGGGTAATAATCAGATCTTTCCCAAGACAGGCCTTCTGATAATCGTCCTGGGCACAATTGCAATGGAGGGCGACAGCGCCTCTGAGGAGGAAATCTGGGAGGAGCTGGGTGTGATGGGGGTGTATGATGGGAGGGAGCACACTGTCTATGGGGAGCCCAGGAAACTGCTCACCCAAGATTGGGTGCAGGAAAACTACCTGGAGTACCGGCAGGTACCCGGCAGTAATCCTGCGCGCTATGAGTTCCTGTGGGGTCCAAGGGCTCTGGCTGAAACCAGCTATGTGAAAGTCCTGGAGCATGTGGTCAGGGTCAATGCAAGAGTTCGCATTGCCTACCCATCCCTGCGTGAAGCAGCTTTGTTAGAGGAGGAAGAGGGAGTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0077-Ab Anti-MAGEA4 monoclonal antibody
    Target Antigen GM-Tg-g-IP0077-Ag MAGEA4 protein
    ORF Viral Vector pGMLP004051 Human MAGEA4 Lentivirus plasmid
    ORF Viral Vector vGMLP004051 Human MAGEA4 Lentivirus particle


    Target information

    Target ID GM-IP0077
    Target Name MAGEA4
    Gene ID 4103, 17140, 710825
    Gene Symbol and Synonyms CT1.4,MAGE-41,Mage-a4,MAGE-X2,MAGE4,MAGE4A,MAGE4B,MAGEA4
    Uniprot Accession P43358
    Uniprot Entry Name MAGA4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000147381
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.