Human C2orf40/ECRG4 ORF/cDNA clone-Lentivirus particle (NM_032411)

Cat. No.: vGMLP004124

Pre-made Human C2orf40/ECRG4 Lentiviral expression plasmid for C2orf40 lentivirus packaging, C2orf40 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to C2orf40/ECRG4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004124 Human C2orf40 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004124
Gene Name C2orf40
Accession Number NM_032411
Gene ID 84417
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 447 bp
Gene Alias ECRG4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGCCTCCCCCGCGCGGCCTGCTGTCCTGGCCCTGACCGGGCTGGCGCTGCTCCTGCTCCTGTGCTGGGGCCCAGGTGGCATAAGTGGAAATAAACTCAAGCTGATGCTTCAAAAACGAGAAGCACCTGTTCCAACTAAGACTAAAGTGGCCGTTGATGAGAATAAAGCCAAAGAATTCCTTGGCAGCCTGAAGCGCCAGAAGCGGCAGCTGTGGGACCGGACTCGGCCCGAGGTGCAGCAGTGGTACCAGCAGTTTCTCTACATGGGCTTTGACGAAGCGAAATTTGAAGATGACATCACCTATTGGCTTAACAGAGATCGAAATGGACATGAATACTATGGCGATTACTACCAACGTCACTATGATGAAGACTCTGCAATTGGTCCCCGGAGCCCCTACGGCTTTAGGCATGGAGCCAGCGTCAACTACGATGACTACTAA
ORF Protein Sequence MAASPARPAVLALTGLALLLLLCWGPGGISGNKLKLMLQKREAPVPTKTKVAVDENKAKEFLGSLKRQKRQLWDRTRPEVQQWYQQFLYMGFDEAKFEDDITYWLNRDRNGHEYYGDYYQRHYDEDSAIGPRSPYGFRHGASVNYDDY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0058-Ab Anti-AUGN/ C2orf40/ ECRG4 functional antibody
    Target Antigen GM-Tg-g-SE0058-Ag C2orf40 protein
    ORF Viral Vector pGMLP004124 Human C2orf40 Lentivirus plasmid
    ORF Viral Vector vGMLP004124 Human C2orf40 Lentivirus particle


    Target information

    Target ID GM-SE0058
    Target Name C2orf40
    Gene ID 84417, 78896, 713611, 363225, 101099368, 611190, 515133, 100049813
    Gene Symbol and Synonyms 1500015O10Rik,C10H2orf40,C11H2orf40,C13H2orf40,C15H2orf40,C2orf40,CA3H2orf40,ECRG4,RGD1305645
    Uniprot Accession Q9H1Z8
    Uniprot Entry Name AUGN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000119147
    Target Classification Tumor-associated antigen (TAA)

    Enables neuropeptide hormone activity. Involved in neuropeptide signaling pathway; positive regulation of hormone secretion; and vasopressin secretion. Located in apical plasma membrane; dense core granule; and extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.