Human ACP5/HPAP/TRACP5a ORF/cDNA clone-Lentivirus particle (NM_001111034)

Cat. No.: vGMLP004133

Pre-made Human ACP5/HPAP/TRACP5a Lentiviral expression plasmid for ACP5 lentivirus packaging, ACP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ACP5/HPAP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004133 Human ACP5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004133
Gene Name ACP5
Accession Number NM_001111034
Gene ID 54
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 978 bp
Gene Alias HPAP,TRACP5a,TRACP5b,TRAP,TrATPase
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACATGTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGATGGTGCCACCCCTGCCCTGCGCTTTGTAGCCGTGGGTGACTGGGGAGGGGTCCCCAATGCCCCATTCCACACGGCCCGGGAAATGGCCAATGCCAAGGAGATCGCTCGGACTGTGCAGATCCTGGGTGCAGACTTCATCCTGTCTCTAGGGGACAATTTTTACTTCACTGGTGTGCAAGACATCAATGACAAGAGGTTCCAGGAGACCTTTGAGGACGTATTCTCTGACCGCTCCCTTCGCAAAGTGCCCTGGTACGTGCTAGCCGGAAACCATGACCACCTTGGCAATGTCTCTGCCCAGATTGCATACTCTAAGATCTCCAAGCGCTGGAACTTCCCCAGCCCTTTCTACCGCCTGCACTTCAAGATCCCACAGACCAATGTGTCTGTGGCCATTTTTATGCTGGACACAGTGACACTATGTGGCAACTCAGATGACTTCCTCAGCCAGCAGCCTGAGAGGCCCCGAGACGTGAAGCTGGCCCGCACACAGCTGTCCTGGCTCAAGAAACAGCTGGCGGCGGCCAGGGAGGACTACGTGCTGGTGGCTGGCCACTACCCCGTGTGGTCCATAGCCGAGCACGGGCCTACCCACTGCCTGGTCAAGCAGCTACGGCCACTGCTGGCCACATACGGGGTCACTGCCTACCTGTGCGGCCACGATCACAATCTGCAGTACCTGCAAGATGAGAATGGCGTGGGCTACGTGCTGAGTGGGGCTGGGAATTTCATGGACCCCTCAAAGCGGCACCAGCGCAAGGTCCCCAACGGCTATCTGCGCTTCCACTATGGGACTGAAGACTCACTGGGTGGCTTTGCCTATGTGGAGATCAGCTCCAAAGAGATGACTGTCACTTACATCGAGGCCTCGGGCAAGTCCCTCTTTAAGACCAGGCTGCCGAGGCGAGCCAGGCCCTGA
ORF Protein Sequence MDMWTALLILQALLLPSLADGATPALRFVAVGDWGGVPNAPFHTAREMANAKEIARTVQILGADFILSLGDNFYFTGVQDINDKRFQETFEDVFSDRSLRKVPWYVLAGNHDHLGNVSAQIAYSKISKRWNFPSPFYRLHFKIPQTNVSVAIFMLDTVTLCGNSDDFLSQQPERPRDVKLARTQLSWLKKQLAAAREDYVLVAGHYPVWSIAEHGPTHCLVKQLRPLLATYGVTAYLCGHDHNLQYLQDENGVGYVLSGAGNFMDPSKRHQRKVPNGYLRFHYGTEDSLGGFAYVEISSKEMTVTYIEASGKSLFKTRLPRRARP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1442-Ab Anti-PPA5/ ACP5/ HPAP functional antibody
    Target Antigen GM-Tg-g-SE1442-Ag ACP5 protein
    ORF Viral Vector pGMLP004133 Human ACP5 Lentivirus plasmid
    ORF Viral Vector vGMLP004133 Human ACP5 Lentivirus particle


    Target information

    Target ID GM-SE1442
    Target Name ACP5
    Gene ID 54, 11433, 715071, 25732, 101100541, 476705, 517002, 100056621
    Gene Symbol and Synonyms ACP5,HPAP,TRAcP,TRACP5a,TRACP5b,TRAP,TrATPase,TTRRAP
    Uniprot Accession P13686
    Uniprot Entry Name PPA5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102575
    Target Classification Not Available

    This gene encodes an iron containing glycoprotein which catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is the most basic of the acid phosphatases and is the only form not inhibited by L(+)-tartrate. [provided by RefSeq, Aug 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.