Human GET3/ARSA-I/ ARSA1 ORF/cDNA clone-Lentivirus particle (NM_004317)

Pre-made Human GET3/ARSA-I/ ARSA1 Lentiviral expression plasmid for GET3 lentivirus packaging, GET3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ARSA/GET3/ARSA-I products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004303 Human GET3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004303
Gene Name GET3
Accession Number NM_004317
Gene ID 439
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1047 bp
Gene Alias ARSA-I, ARSA1, ASNA-I, GET3, TRC40
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGCAGGGGTGGCCGGGTGGGGGGTTGAGGCAGAGGAGTTCGAAGATGCTCCTGATGTGGAGCCGCTGGAGCCTACACTTAGCAACATCATCGAGCAGCGCAGCCTGAAGTGGATCTTCGTCGGGGGCAAGGGTGGTGTGGGCAAGACCACCTGCAGCTGCAGCCTGGCAGTCCAGCTCTCCAAGGGGCGTGAGAGTGTTCTGATCATCTCCACAGACCCAGCACACAACATCTCAGATGCTTTTGACCAGAAGTTCTCAAAGGTGCCTACCAAGGTCAAAGGCTATGACAACCTCTTTGCTATGGAGATTGACCCCAGCCTGGGCGTGGCGGAGCTGCCTGACGAGTTCTTCGAGGAGGACAACATGCTGAGCATGGGCAAGAAGATGATGCAGGAGGCCATGAGCGCATTTCCCGGCATCGATGAGGCCATGAGCTATGCCGAGGTCATGAGGCTGGTGAAGGGCATGAACTTCTCGGTGGTGGTATTTGACACGGCACCCACGGGCCACACCCTGAGGCTGCTCAACTTCCCCACCATCGTGGAGCGGGGCCTGGGCCGGCTTATGCAGATCAAGAACCAGATCAGCCCTTTCATCTCACAGATGTGCAACATGCTGGGCCTGGGGGACATGAACGCAGACCAGCTGGCCTCCAAGCTGGAGGAGACGCTGCCCGTCATCCGCTCAGTCAGCGAACAGTTCAAGGACCCTGAGCAGACAACTTTCATCTGCGTATGCATTGCTGAGTTCCTGTCCCTGTATGAGACAGAGAGGCTGATCCAGGAGCTGGCCAAGTGCAAGATTGACACACACAATATAATTGTCAACCAGCTCGTCTTCCCCGACCCCGAGAAGCCCTGCAAGATGTGTGAGGCCCGTCACAAGATCCAGGCCAAGTATCTGGACCAGATGGAGGACCTGTATGAAGACTTCCACATCGTGAAGCTGCCGCTGTTACCCCATGAGGTGCGGGGGGCAGACAAGGTCAACACCTTCTCGGCCCTCCTCCTGGAGCCCTACAAGCCCCCCAGTGCCCAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T98157-Ab Anti-ARSA/ GET3/ ARSA functional antibody
    Target Antigen GM-Tg-g-T98157-Ag ARSA protein
    ORF Viral Vector pGMLP001051 Human ARSA Lentivirus plasmid
    ORF Viral Vector pGMLP004303 Human GET3 Lentivirus plasmid
    ORF Viral Vector vGMLP001051 Human ARSA Lentivirus particle
    ORF Viral Vector vGMLP004303 Human GET3 Lentivirus particle


    Target information

    Target ID GM-T98157
    Target Name ARSA
    Gene ID 410, 11883, 716500, 315222, 101083690, 474457, 505514, 100056911
    Gene Symbol and Synonyms ARSA,As-2,AS-A,As2,ASA,MLD,TISP73
    Uniprot Accession P15289, O43681
    Uniprot Entry Name ARSA_HUMAN,GET3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100299
    Target Classification Not Available

    The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.