Human GET3/ARSA-I/ ARSA1 ORF/cDNA clone-Lentivirus particle (NM_004317)
Pre-made Human GET3/ARSA-I/ ARSA1 Lentiviral expression plasmid for GET3 lentivirus packaging, GET3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ARSA/GET3/ARSA-I products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004303 | Human GET3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004303 |
Gene Name | GET3 |
Accession Number | NM_004317 |
Gene ID | 439 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1047 bp |
Gene Alias | ARSA-I, ARSA1, ASNA-I, GET3, TRC40 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCAGGGGTGGCCGGGTGGGGGGTTGAGGCAGAGGAGTTCGAAGATGCTCCTGATGTGGAGCCGCTGGAGCCTACACTTAGCAACATCATCGAGCAGCGCAGCCTGAAGTGGATCTTCGTCGGGGGCAAGGGTGGTGTGGGCAAGACCACCTGCAGCTGCAGCCTGGCAGTCCAGCTCTCCAAGGGGCGTGAGAGTGTTCTGATCATCTCCACAGACCCAGCACACAACATCTCAGATGCTTTTGACCAGAAGTTCTCAAAGGTGCCTACCAAGGTCAAAGGCTATGACAACCTCTTTGCTATGGAGATTGACCCCAGCCTGGGCGTGGCGGAGCTGCCTGACGAGTTCTTCGAGGAGGACAACATGCTGAGCATGGGCAAGAAGATGATGCAGGAGGCCATGAGCGCATTTCCCGGCATCGATGAGGCCATGAGCTATGCCGAGGTCATGAGGCTGGTGAAGGGCATGAACTTCTCGGTGGTGGTATTTGACACGGCACCCACGGGCCACACCCTGAGGCTGCTCAACTTCCCCACCATCGTGGAGCGGGGCCTGGGCCGGCTTATGCAGATCAAGAACCAGATCAGCCCTTTCATCTCACAGATGTGCAACATGCTGGGCCTGGGGGACATGAACGCAGACCAGCTGGCCTCCAAGCTGGAGGAGACGCTGCCCGTCATCCGCTCAGTCAGCGAACAGTTCAAGGACCCTGAGCAGACAACTTTCATCTGCGTATGCATTGCTGAGTTCCTGTCCCTGTATGAGACAGAGAGGCTGATCCAGGAGCTGGCCAAGTGCAAGATTGACACACACAATATAATTGTCAACCAGCTCGTCTTCCCCGACCCCGAGAAGCCCTGCAAGATGTGTGAGGCCCGTCACAAGATCCAGGCCAAGTATCTGGACCAGATGGAGGACCTGTATGAAGACTTCCACATCGTGAAGCTGCCGCTGTTACCCCATGAGGTGCGGGGGGCAGACAAGGTCAACACCTTCTCGGCCCTCCTCCTGGAGCCCTACAAGCCCCCCAGTGCCCAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T98157-Ab | Anti-ARSA/ GET3/ ARSA functional antibody |
Target Antigen | GM-Tg-g-T98157-Ag | ARSA protein |
ORF Viral Vector | pGMLP001051 | Human ARSA Lentivirus plasmid |
ORF Viral Vector | pGMLP004303 | Human GET3 Lentivirus plasmid |
ORF Viral Vector | vGMLP001051 | Human ARSA Lentivirus particle |
ORF Viral Vector | vGMLP004303 | Human GET3 Lentivirus particle |
Target information
Target ID | GM-T98157 |
Target Name | ARSA |
Gene ID | 410, 11883, 716500, 315222, 101083690, 474457, 505514, 100056911 |
Gene Symbol and Synonyms | ARSA,As-2,AS-A,As2,ASA,MLD,TISP73 |
Uniprot Accession | P15289, O43681 |
Uniprot Entry Name | ARSA_HUMAN,GET3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000100299 |
Target Classification | Not Available |
The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.