Human SCGB1D4/IIS ORF/cDNA clone-Lentivirus particle (NM_206998)

Pre-made Human SCGB1D4/IIS Lentiviral expression plasmid for SCGB1D4 lentivirus packaging, SCGB1D4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SCGB1D4/IIS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004315 Human SCGB1D4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004315
Gene Name SCGB1D4
Accession Number NM_206998
Gene ID 404552
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 252 bp
Gene Alias IIS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCTGTCAGTGTGTCTCCTGATGGTCTCGCTGGCCCTTTGCTGCTACCAGGCCCATGCTCTTGTCTGCCCAGCTGTTGCTTCTGAGATCACAGTCTTCTTATTCTTAAGTGACGCTGCGGTAAACCTCCAAGTTGCCAAACTTAATCCACCTCCAGAAGCTCTTGCAGCCAAGTTGGAAGTGAAGCACTGCACCGATCAGATATCTTTTAAGAAACGACTCTCATTGAAAAAGTCCTGGTGGAAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1266-Ab Anti-SG1D4/ SCGB1D4/ IIS functional antibody
    Target Antigen GM-Tg-g-SE1266-Ag SCGB1D4 protein
    ORF Viral Vector pGMLP004315 Human SCGB1D4 Lentivirus plasmid
    ORF Viral Vector vGMLP004315 Human SCGB1D4 Lentivirus particle


    Target information

    Target ID GM-SE1266
    Target Name SCGB1D4
    Gene ID 404552, 106993221
    Gene Symbol and Synonyms IIS,SCGB1D4
    Uniprot Accession Q6XE38
    Uniprot Entry Name SG1D4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000197745
    Target Classification Not Available

    Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.