Human STATH/STR ORF/cDNA clone-Lentivirus particle (NM_003154)

Pre-made Human STATH/STR Lentiviral expression plasmid for STATH lentivirus packaging, STATH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to STATH/STR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004524 Human STATH Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004524
Gene Name STATH
Accession Number NM_003154
Gene ID 6779
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 189 bp
Gene Alias STR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTTCCTTGTCTTTGCCTTCATCTTGGCTCTCATGGTTTCCATGATTGGAGCTGATTCATCTGAAGAGAAATTTTTGCGTAGAATTGGAAGATTCGGTTATGGGTATGGCCCTTATCAGCCAGTTCCAGAACAACCACTATACCCACAACCATACCAACCACAATACCAACAATATACCTTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1326-Ab Anti-STAT/ STATH/ STR functional antibody
    Target Antigen GM-Tg-g-SE1326-Ag STATH protein
    ORF Viral Vector pGMLP004524 Human STATH Lentivirus plasmid
    ORF Viral Vector vGMLP004524 Human STATH Lentivirus particle


    Target information

    Target ID GM-SE1326
    Target Name STATH
    Gene ID 6779, 689604
    Gene Symbol and Synonyms STATH,STR
    Uniprot Accession P02808
    Uniprot Entry Name STAT_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000126549
    Target Classification Not Available

    Predicted to be involved in ossification. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.