Human TSN/BCLF-1/C3PO ORF/cDNA clone-Lentivirus particle (NM_004622)

Cat. No.: vGMLP004532

Pre-made Human TSN/BCLF-1/C3PO Lentiviral expression plasmid for TSN lentivirus packaging, TSN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TSN/BCLF-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004532 Human TSN Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004532
Gene Name TSN
Accession Number NM_004622
Gene ID 7247
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 687 bp
Gene Alias BCLF-1,C3PO,RCHF1,REHF-1,TBRBP,TRSLN
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTGTGAGCGAGATCTTCGTGGAGCTGCAGGGCTTTTTGGCTGCCGAGCAGGACATCCGAGAGGAAATCAGAAAAGTTGTACAGAGTTTAGAACAAACAGCTCGAGAGATTTTAACTCTACTGCAAGGGGTCCATCAGGGTGCTGGGTTTCAGGACATTCCAAAGAGGTGTTTGAAAGCTCGAGAACATTTTGGTACAGTAAAAACACATCTAACATCTTTGAAGACCAAATTTCCTGCTGAACAGTATTACAGATTTCATGAGCACTGGAGGTTTGTGTTGCAGCGCTTGGTCTTCTTGGCAGCATTTGTTGTGTATTTGGAAACAGAAACACTAGTGACTCGAGAAGCAGTTACAGAAATTCTTGGCATTGAGCCAGATCGGGAGAAAGGATTTCATCTGGATGTAGAAGATTATCTCTCAGGAGTTCTAATTCTTGCCAGTGAACTGTCGAGGCTGTCTGTCAACAGCGTGACTGCTGGAGACTACTCCCGACCCCTCCACATCTCCACCTTCATCAATGAGCTGGATTCCGGTTTTCGCCTTCTCAACCTGAAAAATGACTCCCTGAGGAAGCGCTACGACGGATTGAAATATGACGTGAAGAAAGTAGAGGAAGTGGTCTATGATCTCTCCATCCGGGGCTTTAATAAGGAGACGGCAGCAGCTTGTGTTGAAAAATAG
ORF Protein Sequence MSVSEIFVELQGFLAAEQDIREEIRKVVQSLEQTAREILTLLQGVHQGAGFQDIPKRCLKAREHFGTVKTHLTSLKTKFPAEQYYRFHEHWRFVLQRLVFLAAFVVYLETETLVTREAVTEILGIEPDREKGFHLDVEDYLSGVLILASELSRLSVNSVTAGDYSRPLHISTFINELDSGFRLLNLKNDSLRKRYDGLKYDVKKVEEVVYDLSIRGFNKETAAACVEK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2181-Ab Anti-TSN monoclonal antibody
    Target Antigen GM-Tg-g-IP2181-Ag TSN protein
    ORF Viral Vector pGMLP004532 Human TSN Lentivirus plasmid
    ORF Viral Vector vGMLP004532 Human TSN Lentivirus particle


    Target information

    Target ID GM-IP2181
    Target Name TSN
    Gene ID 7247, 22099, 697313, 60381, 101099390, 100856243, 509943, 100055077
    Gene Symbol and Synonyms 2610034C24Rik,BCLF-1,C3PO,RCHF1,REHF-1,TB-RBP,TBRBP,TRSLN,TSN
    Uniprot Accession Q15631
    Uniprot Entry Name TSN_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000211460
    Target Classification Not Available

    This gene encodes a DNA-binding protein which specifically recognizes conserved target sequences at the breakpoint junction of chromosomal translocations. Translin polypeptides form a multimeric structure that is responsible for its DNA-binding activity. Recombination-associated motifs and translin-binding sites are present at recombination hotspots and may serve as indicators of breakpoints in genes which are fused by translocations. These binding activities may play a crucial role in chromosomal translocation in lymphoid neoplasms. This protein encoded by this gene, when complexed with translin-associated protein X, also forms a Mg ion-dependent endoribonuclease that promotes RNA-induced silencing complex (RISC) activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.