Human APLN/APEL/ XNPEP2 ORF/cDNA clone-Lentivirus particle (NM_017413)

Pre-made Human APLN/APEL/ XNPEP2 Lentiviral expression plasmid for APLN lentivirus packaging, APLN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to Apelin/APLN/APEL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004562 Human APLN Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004562
Gene Name APLN
Accession Number NM_017413
Gene ID 8862
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 234 bp
Gene Alias APEL, XNPEP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATCTGCGGCTCTGCGTGCAGGCGCTCCTGCTGCTCTGGCTCTCCTTGACCGCGGTGTGTGGAGGGTCCCTGATGCCGCTTCCCGATGGGAATGGGCTGGAAGACGGCAATGTCCGCCACCTGGTGCAGCCCAGAGGGTCAAGGAATGGGCCAGGGCCCTGGCAGGGAGGTCGGAGGAAATTCCGCCGCCAGCGGCCCCGCCTCTCCCATAAGGGACCCATGCCTTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58674-Ab Anti-APEL/ Apelin/ APLN functional antibody
    Target Antigen GM-Tg-g-T58674-Ag Apelin/APLN protein
    Cytokine cks-Tg-g-GM-T58674 apelin (APLN) protein & antibody
    ORF Viral Vector pGMLP004562 Human APLN Lentivirus plasmid
    ORF Viral Vector vGMLP004562 Human APLN Lentivirus particle


    Target information

    Target ID GM-T58674
    Target Name Apelin
    Gene ID 8862, 30878, 702695, 58812, 101101295, 611497, 282143, 102149746
    Gene Symbol and Synonyms 6030430G11Rik,APEL,APLN,XNPEP2
    Uniprot Accession Q9ULZ1
    Uniprot Entry Name APEL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000171388
    Target Classification Not Available

    This gene encodes a peptide that functions as an endogenous ligand for the G-protein coupled apelin receptor. The encoded preproprotein is proteolytically processed into biologically active C-terminal peptide fragments. These peptide fragments activate different tissue specific signaling pathways that regulate diverse biological functions including fluid homeostasis, cardiovascular function and insulin secretion. This protein also functions as a coreceptor for the human immunodeficiency virus 1. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.