Human ASCL1/ASH1/ bHLHa46 ORF/cDNA clone-Lentivirus particle (NM_004316)

Pre-made Human ASCL1/ASH1/ bHLHa46 Lentiviral expression plasmid for ASCL1 lentivirus packaging, ASCL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ASCL1/ASH1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004565 Human ASCL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004565
Gene Name ASCL1
Accession Number NM_004316
Gene ID 429
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 711 bp
Gene Alias ASH1, bHLHa46, HASH1, MASH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAAAGCTCTGCCAAGATGGAGAGCGGCGGCGCCGGCCAGCAGCCCCAGCCGCAGCCCCAGCAGCCCTTCCTGCCGCCCGCAGCCTGTTTCTTTGCCACGGCCGCAGCCGCGGCGGCCGCAGCCGCCGCAGCGGCAGCGCAGAGCGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGCCGCAGCTGAGACCGGCGGCCGACGGCCAGCCCTCAGGGGGCGGTCACAAGTCAGCGCCCAAGCAAGTCAAGCGACAGCGCTCGTCTTCGCCCGAACTGATGCGCTGCAAACGCCGGCTCAACTTCAGCGGCTTTGGCTACAGCCTGCCGCAGCAGCAGCCGGCCGCCGTGGCGCGCCGCAACGAGCGCGAGCGCAACCGCGTCAAGTTGGTCAACCTGGGCTTTGCCACCCTTCGGGAGCACGTCCCCAACGGCGCGGCCAACAAGAAGATGAGTAAGGTGGAGACACTGCGCTCGGCGGTCGAGTACATCCGCGCGCTGCAGCAGCTGCTGGACGAGCATGACGCGGTGAGCGCCGCCTTCCAGGCAGGCGTCCTGTCGCCCACCATCTCCCCCAACTACTCCAACGACTTGAACTCCATGGCCGGCTCGCCGGTCTCATCCTACTCGTCGGACGAGGGCTCTTACGACCCGCTCAGCCCCGAGGAGCAGGAGCTTCTCGACTTCACCAACTGGTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1510-Ab Anti-ASCL1/ ASH1/ HASH1 functional antibody
    Target Antigen GM-Tg-g-SE1510-Ag ASCL1 protein
    ORF Viral Vector pGMAAV000356 Rat Ascl1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP004565 Human ASCL1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000356 Rat Ascl1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP004565 Human ASCL1 Lentivirus particle


    Target information

    Target ID GM-SE1510
    Target Name ASCL1
    Gene ID 429, 17172, 698820, 64186, 101081993, 482628, 540473, 100146286
    Gene Symbol and Synonyms ASCL1,ASH1,bHLHa46,HASH1,MASH1
    Uniprot Accession P50553
    Uniprot Entry Name ASCL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000139352
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.