Human Pex11a/hsPEX11p/PEX11-ALPHA ORF/cDNA clone-Lentivirus particle (NM_003847)
Cat. No.: vGMLP004695
Pre-made Human Pex11a/hsPEX11p/PEX11-ALPHA Lentiviral expression plasmid for Pex11a lentivirus packaging, Pex11a lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PEX11A/Pex11a/hsPEX11p products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004695 | Human Pex11a Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004695 |
Gene Name | Pex11a |
Accession Number | NM_003847 |
Gene ID | 8800 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 744 bp |
Gene Alias | hsPEX11p,PEX11-ALPHA,PMP28 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGACGCCTTCACCCGCTTCACCAACCAGACCCAGGGCCGGGACCGACTCTTCAGAGCCACTCAGTACACATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAAACTGGAGTCCAGTGTGAGCACTGGTCGTAAATGGTTCAGACTAGGCAATGTGGTACATGCTATACAGGCAACTGAGCAGAGCATTCATGCCACTGACCTGGTACCTCGCTTATGCTTAACATTAGCCAACCTGAACCGTGTGATTTATTTCATCTGTGACACCATCCTCTGGGTGAGGAGCGTAGGTCTCACCTCTGGCATCAACAAAGAGAAATGGCGAACGAGGGCTGCTCACCACTACTACTATTCTCTTCTGCTGAGCCTGGTCAGGGATCTGTATGAAATCTCCCTGCAGATGAAACGAGTTACATGTGACAGGGCAAAGAAAGAGAAATCAGCATCCCAGGATCCTCTTTGGTTCAGCGTGGCTGAGGAGGAAACAGAATGGCTCCAATCCTTTCTACTTCTTTTATTCCGATCTCTGAAGCAGCATCCTCCCTTGCTCCTGGACACAGTGAAGAACCTTTGTGATATCCTGAACCCTTTGGACCAGCTGGGGATCTATAAATCCAATCCTGGCATCATTGGACTTGGAGGTCTTGTGTCCTCTATAGCAGGCATGATCACTGTGGCATATCCTCAGATGAAGCTGAAGACCCGTTAG |
ORF Protein Sequence | MDAFTRFTNQTQGRDRLFRATQYTCMLLRYLLEPKAGKEKVVMKLKKLESSVSTGRKWFRLGNVVHAIQATEQSIHATDLVPRLCLTLANLNRVIYFICDTILWVRSVGLTSGINKEKWRTRAAHHYYYSLLLSLVRDLYEISLQMKRVTCDRAKKEKSASQDPLWFSVAEEETEWLQSFLLLLFRSLKQHPPLLLDTVKNLCDILNPLDQLGIYKSNPGIIGLGGLVSSIAGMITVAYPQMKLKTR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1365-Ab | Anti-PEX11A monoclonal antibody |
Target Antigen | GM-Tg-g-IP1365-Ag | PEX11A protein |
ORF Viral Vector | pGMLP004695 | Human Pex11a Lentivirus plasmid |
ORF Viral Vector | vGMLP004695 | Human Pex11a Lentivirus particle |
Target information
Target ID | GM-IP1365 |
Target Name | PEX11A |
Gene ID | 8800, 18631, 700511, 85249, 101083084, 100856425, 515608, 100053729 |
Gene Symbol and Synonyms | hsPEX11p,PEX11-ALPHA,PEX11A,PEX11alpha,Pmp26p,PMP28 |
Uniprot Accession | O75192 |
Uniprot Entry Name | PX11A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000166821 |
Target Classification | Not Available |
This gene is a member of the PEX11 family, which is composed of membrane elongation factors involved in regulation of peroxisome maintenance and proliferation. This gene product interacts with peroxisomal membrane protein 19 and may respond to outside stimuli to increase peroxisome abundance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.