Human Pex11a/hsPEX11p/PEX11-ALPHA ORF/cDNA clone-Lentivirus particle (NM_003847)

Cat. No.: vGMLP004695

Pre-made Human Pex11a/hsPEX11p/PEX11-ALPHA Lentiviral expression plasmid for Pex11a lentivirus packaging, Pex11a lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PEX11A/Pex11a/hsPEX11p products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004695 Human Pex11a Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004695
Gene Name Pex11a
Accession Number NM_003847
Gene ID 8800
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 744 bp
Gene Alias hsPEX11p,PEX11-ALPHA,PMP28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACGCCTTCACCCGCTTCACCAACCAGACCCAGGGCCGGGACCGACTCTTCAGAGCCACTCAGTACACATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAAACTGGAGTCCAGTGTGAGCACTGGTCGTAAATGGTTCAGACTAGGCAATGTGGTACATGCTATACAGGCAACTGAGCAGAGCATTCATGCCACTGACCTGGTACCTCGCTTATGCTTAACATTAGCCAACCTGAACCGTGTGATTTATTTCATCTGTGACACCATCCTCTGGGTGAGGAGCGTAGGTCTCACCTCTGGCATCAACAAAGAGAAATGGCGAACGAGGGCTGCTCACCACTACTACTATTCTCTTCTGCTGAGCCTGGTCAGGGATCTGTATGAAATCTCCCTGCAGATGAAACGAGTTACATGTGACAGGGCAAAGAAAGAGAAATCAGCATCCCAGGATCCTCTTTGGTTCAGCGTGGCTGAGGAGGAAACAGAATGGCTCCAATCCTTTCTACTTCTTTTATTCCGATCTCTGAAGCAGCATCCTCCCTTGCTCCTGGACACAGTGAAGAACCTTTGTGATATCCTGAACCCTTTGGACCAGCTGGGGATCTATAAATCCAATCCTGGCATCATTGGACTTGGAGGTCTTGTGTCCTCTATAGCAGGCATGATCACTGTGGCATATCCTCAGATGAAGCTGAAGACCCGTTAG
ORF Protein Sequence MDAFTRFTNQTQGRDRLFRATQYTCMLLRYLLEPKAGKEKVVMKLKKLESSVSTGRKWFRLGNVVHAIQATEQSIHATDLVPRLCLTLANLNRVIYFICDTILWVRSVGLTSGINKEKWRTRAAHHYYYSLLLSLVRDLYEISLQMKRVTCDRAKKEKSASQDPLWFSVAEEETEWLQSFLLLLFRSLKQHPPLLLDTVKNLCDILNPLDQLGIYKSNPGIIGLGGLVSSIAGMITVAYPQMKLKTR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1365-Ab Anti-PEX11A monoclonal antibody
    Target Antigen GM-Tg-g-IP1365-Ag PEX11A protein
    ORF Viral Vector pGMLP004695 Human Pex11a Lentivirus plasmid
    ORF Viral Vector vGMLP004695 Human Pex11a Lentivirus particle


    Target information

    Target ID GM-IP1365
    Target Name PEX11A
    Gene ID 8800, 18631, 700511, 85249, 101083084, 100856425, 515608, 100053729
    Gene Symbol and Synonyms hsPEX11p,PEX11-ALPHA,PEX11A,PEX11alpha,Pmp26p,PMP28
    Uniprot Accession O75192
    Uniprot Entry Name PX11A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166821
    Target Classification Not Available

    This gene is a member of the PEX11 family, which is composed of membrane elongation factors involved in regulation of peroxisome maintenance and proliferation. This gene product interacts with peroxisomal membrane protein 19 and may respond to outside stimuli to increase peroxisome abundance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.