Human HSPB3/DHMN2C/HMN2C ORF/cDNA clone-Lentivirus particle (NM_006308)

Cat. No.: vGMLP004699

Pre-made Human HSPB3/DHMN2C/HMN2C Lentiviral expression plasmid for HSPB3 lentivirus packaging, HSPB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to HSP27/HSPB3/DHMN2C products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004699 Human HSPB3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004699
Gene Name HSPB3
Accession Number NM_006308
Gene ID 8988
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 453 bp
Gene Alias DHMN2C,HMN2C,HSPL27
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAAAAATCATTTTGAGGCACCTCATAGAGATTCCAGTGCGTTACCAGGAAGAGTTTGAAGCTCGAGGTCTAGAAGACTGCAGGCTGGATCATGCTTTATATGCACTGCCTGGGCCAACCATCGTGGACCTGAGGAAAACCAGGGCAGCGCAGTCTCCTCCAGTGGACTCAGCGGCAGAGACGCCACCCCGAGAAGGCAAATCCCACTTTCAGATCCTGCTGGACGTGGTCCAGTTCCTCCCTGAAGACATCATCATTCAGACCTTCGAAGGCTGGCTGCTGATAAAAGCACAACACGGAACCAGAATGGATGAGCACGGTTTTATCTCAAGAAGCTTCACCCGACAGTACAAACTACCAGATGGTGTGGAAATCAAAGATTTGTCTGCAGTCCTCTGTCATGATGGAATTTTGGTGGTGGAAGTAAAGGATCCAGTTGGGACTAAGTGA
ORF Protein Sequence MAKIILRHLIEIPVRYQEEFEARGLEDCRLDHALYALPGPTIVDLRKTRAAQSPPVDSAAETPPREGKSHFQILLDVVQFLPEDIIIQTFEGWLLIKAQHGTRMDEHGFISRSFTRQYKLPDGVEIKDLSAVLCHDGILVVEVKDPVGTK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68517-Ab Anti-HSP27 monoclonal antibody
    Target Antigen GM-Tg-g-T68517-Ag HSP27/HSPB3 protein
    ORF Viral Vector pGMLP004699 Human HSPB3 Lentivirus plasmid
    ORF Viral Vector vGMLP004699 Human HSPB3 Lentivirus particle


    Target information

    Target ID GM-T68517
    Target Name HSP27
    Gene ID 8988, 56534, 704576, 78951, 101088721, 102156019, 616007, 100052250
    Gene Symbol and Synonyms 2310035K17Rik,DHMN2C,HMN2C,Hsbp3,HSPB3,HSPL27,spb3
    Uniprot Accession Q12988
    Uniprot Entry Name HSPB3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000169271
    Target Classification Not Available

    This gene encodes a muscle-specific small heat shock protein. A mutation in this gene is the cause of autosomal dominant distal hereditary motor neuropathy type 2C.[provided by RefSeq, Sep 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.