Human FGF22 ORF/cDNA clone-Lentivirus particle (NM_020637)

Pre-made Human FGF22/ Lentiviral expression plasmid for FGF22 lentivirus packaging, FGF22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FGF22/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004721 Human FGF22 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004721
Gene Name FGF22
Accession Number NM_020637
Gene ID 27006
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 513 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCCGCCGCCTGTGGCTGGGCCTGGCCTGGCTGCTGCTGGCGCGGGCGCCGGACGCCGCGGGAACCCCGAGCGCGTCGCGGGGACCGCGCAGCTACCCGCACCTGGAGGGCGACGTGCGCTGGCGGCGCCTCTTCTCCTCCACTCACTTCTTCCTGCGCGTGGATCCCGGCGGCCGCGTGCAGGGCACCCGCTGGCGCCACGGCCAGGACAGCATCCTGGAGATCCGCTCTGTACACGTGGGCGTCGTGGTCATCAAAGCAGTGTCCTCAGGCTTCTACGTGGCCATGAACCGCCGGGGCCGCCTCTACGGGTCGCGACTCTACACCGTGGACTGCAGGTTCCGGGAGCGCATCGAAGAGAACGGCCACAACACCTACGCCTCACAGCGCTGGCGCCGCCGCGGCCAGCCCATGTTCCTGGCGCTGGACAGGAGGGGGGGGCCCCGGCCAGGCGGCCGGACGCGGCGGTACCACCTGTCCGCCCACTTCCTGCCCGTCCTGGTCTCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0920-Ab Anti-FGF22 functional antibody
    Target Antigen GM-Tg-g-SE0920-Ag FGF22 protein
    Cytokine cks-Tg-g-GM-SE0920 fibroblast growth factor 22 (FGF22) protein & antibody
    ORF Viral Vector pGMLP004721 Human FGF22 Lentivirus plasmid
    ORF Viral Vector vGMLP004721 Human FGF22 Lentivirus particle


    Target information

    Target ID GM-SE0920
    Target Name FGF22
    Gene ID 27006, 67112, 702727, 170579, 101083745, 612404, 519657, 100072461
    Gene Symbol and Synonyms 2210414E06Rik,FGF-22,FGF22,Fgf5d
    Uniprot Accession Q9HCT0
    Uniprot Entry Name FGF22_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000070388
    Target Classification Not Available

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.