Human HN1/HN1 ORF/cDNA clone-Lentivirus particle (NM_001190452)

Cat. No.: vGMLP004731

Pre-made Human HN1/HN1 Lentiviral expression plasmid for HN1 lentivirus packaging, HN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MTRNR2L1/HN1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004731 Human HN1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004731
Gene Name HN1
Accession Number NM_001190452
Gene ID 100462977
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 75 bp
Gene Alias HN1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCCACGAGGGTTCAGCTGTCTCTTACTTTCAACCAGTGAAATTGACCTGCCCGTGAAGAGGCGGACATAA
ORF Protein Sequence MAPRGFSCLLLSTSEIDLPVKRRT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1105-Ab Anti-HMN1/ MTRNR2L1/ HN1 functional antibody
    Target Antigen GM-Tg-g-SE1105-Ag MTRNR2L1 protein
    ORF Viral Vector pGMLP004731 Human HN1 Lentivirus plasmid
    ORF Viral Vector vGMLP004731 Human HN1 Lentivirus particle


    Target information

    Target ID GM-SE1105
    Target Name MTRNR2L1
    Gene ID 100462977
    Gene Symbol and Synonyms HN1,MTRNR2L1
    Uniprot Accession P0CJ68
    Uniprot Entry Name HMN1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000256618
    Target Classification Not Available

    Predicted to enable receptor antagonist activity. Predicted to be involved in negative regulation of execution phase of apoptosis. Predicted to be located in cytoplasm and extracellular region. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.