Human MRPL35/L35mt/ MRP-L35 ORF/cDNA clone-Lentivirus particle (NM_016622)

Pre-made Human MRPL35/L35mt/ MRP-L35 Lentiviral expression plasmid for MRPL35 lentivirus packaging, MRPL35 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MRPL35/L35mt products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004733 Human MRPL35 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004733
Gene Name MRPL35
Accession Number NM_016622
Gene ID 51318
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 567 bp
Gene Alias L35mt, MRP-L35
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGCCTCTGCCTTTGCTGGTGCAGTGAGAGCAGCTTCAGGAATCCTACGGCCCCTGAATATTTTGGCATCTTCAACCTACCGCAACTGTGTCAAGAATGCCTCTCTTATTTCTGCATTGTCCACTGGACGTTTTAGTCATATTCAGACACCAGTTGTTTCCTCCACTCCCAGACTTACCACATCTGAGAGAAACCTGACATGTGGGCATACCTCAGTGATCCTTAATAGAATGGCCCCCGTGCTTCCAAGTGTCCTGAAGCTGCCAGTCAGATCTCTAACATACTTCAGTGCAAGAAAAGGCAAGAGAAAGACCGTGAAAGCTGTCATCGATAGGTTTCTTCGACTTCATTGTGGCCTTTGGGTGAGGAGAAAGGCTGGCTATAAGAAAAAATTATGGAAAAAGACACCTGCAAGGAAGAAGCGATTGAGGGAATTTGTATTCTGCAATAAAACCCAGAGTAAACTCTTAGATAAAATGACGACGTCCTTCTGGAAGAGGCGAAACTGGTACGTTGATGATCCTTATCAGAAGTATCATGATCGAACAAACCTGAAAGTATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1497-Ab Anti-RM35/ MRPL35/ L35mt functional antibody
    Target Antigen GM-Tg-g-SE1497-Ag MRPL35 protein
    ORF Viral Vector pGMLP004733 Human MRPL35 Lentivirus plasmid
    ORF Viral Vector vGMLP004733 Human MRPL35 Lentivirus particle


    Target information

    Target ID GM-SE1497
    Target Name MRPL35
    Gene ID 51318, 66223, 717628, 297334, 101088072, 612007, 540278, 100053006
    Gene Symbol and Synonyms 1110066C01Rik,L35mt,MRP-L35,MRPL35
    Uniprot Accession Q9NZE8
    Uniprot Entry Name RM35_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000132313
    Target Classification Not Available

    Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified three transcript variants. Pseudogenes corresponding to this gene are found on chromosomes 6p, 10q, and Xp. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.