Human CCL17/A-152E5.3/ ABCD-2 ORF/cDNA clone-Lentivirus particle (NM_002987)

Pre-made Human CCL17/A-152E5.3/ ABCD-2 Lentiviral expression plasmid for CCL17 lentivirus packaging, CCL17 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL17/A-152E5.3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004761 Human CCL17 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004761
Gene Name CCL17
Accession Number NM_002987
Gene ID 6361
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 285 bp
Gene Alias A-152E5.3, ABCD-2, SCYA17, TARC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCCACTGAAGATGCTGGCCCTGGTCACCCTCCTCCTGGGGGCTTCTCTGCAGCACATCCACGCAGCTCGAGGGACCAATGTGGGCCGGGAGTGCTGCCTGGAGTACTTCAAGGGAGCCATTCCCCTTAGAAAGCTGAAGACGTGGTACCAGACATCTGAGGACTGCTCCAGGGATGCCATCGTTTTTGTAACTGTGCAGGGCAGGGCCATCTGTTCGGACCCCAACAACAAGAGAGTGAAGAATGCAGTTAAATACCTGCAAAGCCTTGAGAGGTCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0742-Ab Anti-CCL17/ A-152E5.3/ ABCD-2 functional antibody
    Target Antigen GM-Tg-g-SE0742-Ag CCL17 protein
    Cytokine cks-Tg-g-GM-SE0742 chemokine (C-C motif) ligand 17 (CCL17) protein & antibody
    ORF Viral Vector pGMLP004761 Human CCL17 Lentivirus plasmid
    ORF Viral Vector vGMLP004761 Human CCL17 Lentivirus particle


    Target information

    Target ID GM-SE0742
    Target Name CCL17
    Gene ID 6361, 20295, 574180, 117518, 493832, 403586, 100140488, 100630824
    Gene Symbol and Synonyms A-152E5.3,ABCD-2,CCL17,SCYA17,Scya17l,TARC
    Uniprot Accession Q92583
    Uniprot Entry Name CCL17_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Breast Cancer, Overactive bladder
    Gene Ensembl ENSG00000102970
    Target Classification Not Available

    This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for T lymphocytes, but not monocytes or granulocytes. The product of this gene binds to chemokine receptors CCR4 and CCR8. This chemokine plays important roles in T cell development in thymus as well as in trafficking and activation of mature T cells. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.